EMAIL THIS PAGE TO A FRIEND

FBXO34

F-box protein 34

290 Gene Product Result for
Synonyms: Fbx34
UniProtKB ID: Q9NWN3, Q2VPB5, Q86TY4
Gene ID:
Human(55030) Summary: Members of the F-box protein family, such as FBXO34, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(78938) F-box protein 34
Rat(305830) F-box protein 34
naked mole-rat(101710337) F-box protein 34
sheep(101118956) F-box protein 34
chicken(423554) F-box protein 34
dog(490703) F-box protein 34
cow(786294) F-box protein 34-like
cow(539922) F-box protein 34
domestic cat(101081987) F-box protein 34
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017943 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017943 Rosetta Predictions human pricing
NM_001107257 Rosetta Predictions rat pricing
NM_030236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154540 predicted 1995
2 SASI_Hs02_00350955 predicted 2069
3 SASI_Hs01_00154541 predicted 1107
4 SASI_Hs01_00154542 predicted 973
5 SASI_Hs01_00154543 predicted 864
6 SASI_Hs01_00154544 predicted 1343
7 SASI_Hs01_00154545 predicted 290
8 SASI_Hs01_00154547 predicted 1232
9 SASI_Hs01_00154548 predicted 384
10 SASI_Hs01_00154549 predicted 607
11 SASI_Hs01_00154546 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227055 predicted 439
2 SASI_Rn02_00227056 predicted 1955
3 SASI_Rn02_00227057 predicted 1425
4 SASI_Rn02_00227058 predicted 1454
5 SASI_Rn02_00227059 predicted 890
6 SASI_Rn02_00227060 predicted 998
7 SASI_Rn02_00227061 predicted 245
8 SASI_Rn02_00227062 predicted 255
9 SASI_Rn02_00227063 predicted 365
10 SASI_Rn02_00227064 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199444 predicted 354
2 SASI_Mm02_00336691 predicted 1369
3 SASI_Mm02_00336692 predicted 1368
4 SASI_Mm01_00199446 predicted 316
5 SASI_Mm01_00199447 predicted 1384
6 SASI_Mm01_00199450 predicted 361
7 SASI_Mm01_00199441 predicted 1115
8 SASI_Mm02_00336693 predicted 541
9 SASI_Mm02_00336694 predicted 1502
10 SASI_Mm02_00336695 predicted 1385
11 SASI_Mm01_00199442 predicted 657
12 SASI_Mm01_00199443 predicted 1089
13 SASI_Mm01_00199445 predicted 2195
14 SASI_Mm01_00199448 predicted 1924
15 SASI_Mm01_00199449 predicted 1894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028406
FBXO34 MISSION shRNA Bacterial Glycerol Stock
F-box protein 34
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000202321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028406.1-180s1c1
Sequence:CCGGGCTGTACTGGAAACTCCAGAACTCGAGTTCTGGAGTTTCCAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028406.1-1421s1c1
Sequence:CCGGGCATAAGAAGAGAGCTTGTAACTCGAGTTACAAGCTCTCTTCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028406.1-654s1c1
Sequence:CCGGGCTAGAAATGATGAGAGAGATCTCGAGATCTCTCTCATCATTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028406
FBXO34 MISSION shRNA shRNA Plasmid DNA
F-box protein 34
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000202321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028406.1-180s1c1
Sequence:CCGGGCTGTACTGGAAACTCCAGAACTCGAGTTCTGGAGTTTCCAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028406.1-1421s1c1
Sequence:CCGGGCATAAGAAGAGAGCTTGTAACTCGAGTTACAAGCTCTCTTCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028406.1-654s1c1
Sequence:CCGGGCTAGAAATGATGAGAGAGATCTCGAGATCTCTCTCATCATTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028406
FBXO34 MISSION shRNA Lentiviral Transduction Particles
F-box protein 34
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000202321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028406.1-180s1c1
Sequence:CCGGGCTGTACTGGAAACTCCAGAACTCGAGTTCTGGAGTTTCCAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028406.1-1421s1c1
Sequence:CCGGGCATAAGAAGAGAGCTTGTAACTCGAGTTACAAGCTCTCTTCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028406.1-654s1c1
Sequence:CCGGGCTAGAAATGATGAGAGAGATCTCGAGATCTCTCTCATCATTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017943
VALIDATED
FBXO34 MISSION shRNA Bacterial Glycerol Stock
F-box protein 34
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017943.2-2566s1c1
Sequence:CCGGGCTGTGAATAACTGCCTGTTTCTCGAGAAACAGGCAGTTATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-1962s1c1
Sequence:CCGGCCAAGAGTTTAGTGGCCCTTACTCGAGTAAGGGCCACTAAACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-346s1c1
Sequence:CCGGCGGTAAAGCATCATCTCGAAACTCGAGTTTCGAGATGATGCTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-310s1c1
Sequence:CCGGCCACATAACATCAAGTGTCTTCTCGAGAAGACACTTGATGTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-2260s1c1
Sequence:CCGGCCACAGCTTTAATCGGGCAATCTCGAGATTGCCCGATTAAAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017943.3-1708s21c1
Sequence:CCGGGTCAGCACTTGTCAGACTATTCTCGAGAATAGTCTGACAAGTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_017943.3-2430s21c1
Sequence:CCGGACCTAGATACACCGTTCAAATCTCGAGATTTGAACGGTGTATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_017943.3-404s21c1
Sequence:CCGGCGGTAAAGCATCATCTCGAAACTCGAGTTTCGAGATGATGCTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017943.3-2318s21c1
Sequence:CCGGCCACAGCTTTAATCGGGCAATCTCGAGATTGCCCGATTAAAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017943.3-2020s21c1
Sequence:CCGGCCAAGAGTTTAGTGGCCCTTACTCGAGTAAGGGCCACTAAACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017943
VALIDATED
FBXO34 MISSION shRNA shRNA Plasmid DNA
F-box protein 34
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017943.2-2566s1c1
Sequence:CCGGGCTGTGAATAACTGCCTGTTTCTCGAGAAACAGGCAGTTATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-1962s1c1
Sequence:CCGGCCAAGAGTTTAGTGGCCCTTACTCGAGTAAGGGCCACTAAACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-346s1c1
Sequence:CCGGCGGTAAAGCATCATCTCGAAACTCGAGTTTCGAGATGATGCTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-310s1c1
Sequence:CCGGCCACATAACATCAAGTGTCTTCTCGAGAAGACACTTGATGTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-2260s1c1
Sequence:CCGGCCACAGCTTTAATCGGGCAATCTCGAGATTGCCCGATTAAAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017943.3-1708s21c1
Sequence:CCGGGTCAGCACTTGTCAGACTATTCTCGAGAATAGTCTGACAAGTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_017943.3-2430s21c1
Sequence:CCGGACCTAGATACACCGTTCAAATCTCGAGATTTGAACGGTGTATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_017943.3-404s21c1
Sequence:CCGGCGGTAAAGCATCATCTCGAAACTCGAGTTTCGAGATGATGCTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017943.3-2318s21c1
Sequence:CCGGCCACAGCTTTAATCGGGCAATCTCGAGATTGCCCGATTAAAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017943.3-2020s21c1
Sequence:CCGGCCAAGAGTTTAGTGGCCCTTACTCGAGTAAGGGCCACTAAACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017943
VALIDATED
FBXO34 MISSION shRNA Lentiviral Transduction Particles
F-box protein 34
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017943.2-2566s1c1
Sequence:CCGGGCTGTGAATAACTGCCTGTTTCTCGAGAAACAGGCAGTTATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-1962s1c1
Sequence:CCGGCCAAGAGTTTAGTGGCCCTTACTCGAGTAAGGGCCACTAAACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-346s1c1
Sequence:CCGGCGGTAAAGCATCATCTCGAAACTCGAGTTTCGAGATGATGCTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-310s1c1
Sequence:CCGGCCACATAACATCAAGTGTCTTCTCGAGAAGACACTTGATGTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017943.2-2260s1c1
Sequence:CCGGCCACAGCTTTAATCGGGCAATCTCGAGATTGCCCGATTAAAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017943.3-1708s21c1
Sequence:CCGGGTCAGCACTTGTCAGACTATTCTCGAGAATAGTCTGACAAGTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_017943.3-2430s21c1
Sequence:CCGGACCTAGATACACCGTTCAAATCTCGAGATTTGAACGGTGTATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_017943.3-404s21c1
Sequence:CCGGCGGTAAAGCATCATCTCGAAACTCGAGTTTCGAGATGATGCTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017943.3-2318s21c1
Sequence:CCGGCCACAGCTTTAATCGGGCAATCTCGAGATTGCCCGATTAAAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017943.3-2020s21c1
Sequence:CCGGCCAAGAGTTTAGTGGCCCTTACTCGAGTAAGGGCCACTAAACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030236
FBXO34 MISSION shRNA Bacterial Glycerol Stock
F-box protein 34
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030236.2-2421s21c1
Sequence:CCGGATGGTGGTGCCTCACATTAAACTCGAGTTTAATGTGAGGCACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-1061s21c1
Sequence:CCGGCGGGAGCTTGTCACGCAATAACTCGAGTTATTGCGTGACAAGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-1405s21c1
Sequence:CCGGCAGATGCTGTCCGTCGCATAACTCGAGTTATGCGACGGACAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-1358s21c1
Sequence:CCGGCAGCCGGGATGACGTAGAAATCTCGAGATTTCTACGTCATCCCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-591s21c1
Sequence:CCGGATCGATGGGAGAGCCACTAAACTCGAGTTTAGTGGCTCTCCCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030236
FBXO34 MISSION shRNA shRNA Plasmid DNA
F-box protein 34
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030236.2-2421s21c1
Sequence:CCGGATGGTGGTGCCTCACATTAAACTCGAGTTTAATGTGAGGCACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-1061s21c1
Sequence:CCGGCGGGAGCTTGTCACGCAATAACTCGAGTTATTGCGTGACAAGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-1405s21c1
Sequence:CCGGCAGATGCTGTCCGTCGCATAACTCGAGTTATGCGACGGACAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-1358s21c1
Sequence:CCGGCAGCCGGGATGACGTAGAAATCTCGAGATTTCTACGTCATCCCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-591s21c1
Sequence:CCGGATCGATGGGAGAGCCACTAAACTCGAGTTTAGTGGCTCTCCCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030236
FBXO34 MISSION shRNA Lentiviral Transduction Particles
F-box protein 34
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030236.2-2421s21c1
Sequence:CCGGATGGTGGTGCCTCACATTAAACTCGAGTTTAATGTGAGGCACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-1061s21c1
Sequence:CCGGCGGGAGCTTGTCACGCAATAACTCGAGTTATTGCGTGACAAGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-1405s21c1
Sequence:CCGGCAGATGCTGTCCGTCGCATAACTCGAGTTATGCGACGGACAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-1358s21c1
Sequence:CCGGCAGCCGGGATGACGTAGAAATCTCGAGATTTCTACGTCATCCCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030236.2-591s21c1
Sequence:CCGGATCGATGGGAGAGCCACTAAACTCGAGTTTAGTGGCTCTCCCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks