EMAIL THIS PAGE TO A FRIEND

FBXO36

F-box protein 36

130 Gene Product Result for
Synonyms: Fbx36
UniProtKB ID: Q8NEA4, Q53TE6, Q8WWD4
Gene ID:
Human(130888) Summary: Members of the F-box protein family, such as FBXO36, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(66153) F-box protein 36
Rat(363268) F-box protein 36
domestic cat(101089885) F-box protein 36
cow(617339) F-box protein 36
dog(100686210) F-box protein 36
sheep(101119965) F-box protein 36
naked mole-rat(101719716) F-box protein 36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174899 Rosetta Predictions human pricing
NM_001108804 Rosetta Predictions rat pricing
NM_025386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160304 predicted 225
2 SASI_Hs01_00160307 predicted 314
3 SASI_Hs01_00160308 predicted 228
4 SASI_Hs01_00160309 predicted 220
5 SASI_Hs01_00160310 predicted 210
6 SASI_Hs02_00368784 predicted 845
7 SASI_Hs01_00160311 predicted 574
8 SASI_Hs02_00368785 predicted 390
9 SASI_Hs02_00368786 predicted 369
10 SASI_Hs02_00368787 predicted 762
11 SASI_Hs01_00160303 predicted 241
12 SASI_Hs01_00160305 predicted 571
13 SASI_Hs01_00160306 predicted 366
14 SASI_Hs01_00160312 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242235 predicted 255
2 SASI_Rn02_00242236 predicted 540
3 SASI_Rn02_00242237 predicted 394
4 SASI_Rn02_00242238 predicted 236
5 SASI_Rn02_00242239 predicted 645
6 SASI_Rn02_00242240 predicted 238
7 SASI_Rn02_00242241 predicted 243
8 SASI_Rn02_00242242 predicted 215
9 SASI_Rn02_00242243 predicted 283
10 SASI_Rn02_00242244 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080955 predicted 275
2 SASI_Mm02_00328118 predicted 624
3 SASI_Mm01_00080956 predicted 343
4 SASI_Mm01_00080957 predicted 470
5 SASI_Mm01_00080958 predicted 242
6 SASI_Mm01_00080959 predicted 415
7 SASI_Mm01_00080960 predicted 641
8 SASI_Mm01_00080961 predicted 385
9 SASI_Mm02_00328119 predicted 415
10 SASI_Mm01_00080962 predicted 229
11 SASI_Mm01_00080963 predicted 637
12 SASI_Mm01_00080964 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174899
FBXO36 MISSION shRNA Bacterial Glycerol Stock
F-box protein 36
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174899.4-690s21c1
Sequence:CCGGGTTGATGCGTGGAGCCATTTGCTCGAGCAAATGGCTCCACGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174899.4-306s21c1
Sequence:CCGGGAACGGCTCTCAGACGATTTGCTCGAGCAAATCGTCTGAGAGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174899.3-347s1c1
Sequence:CCGGCTTGAAGATATTGCCAGGCTTCTCGAGAAGCCTGGCAATATCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174899.3-182s1c1
Sequence:CCGGGAAACCCATGAAGACTTCCTACTCGAGTAGGAAGTCTTCATGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174899.3-218s1c1
Sequence:CCGGCAAGGTCAAACTGCCTTAATACTCGAGTATTAAGGCAGTTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174899.3-394s1c1
Sequence:CCGGGCTGTGCATGTCTGATAAACTCTCGAGAGTTTATCAGACATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174899.3-640s1c1
Sequence:CCGGCCAAATCTCTTCTGTCTCCTTCTCGAGAAGGAGACAGAAGAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174899.3-309s1c1
Sequence:CCGGCAGACGATTTGCTCCTGACTACTCGAGTAGTCAGGAGCAAATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174899.3-756s1c1
Sequence:CCGGCTTGCTAGAGTCACCGTCATTCTCGAGAATGACGGTGACTCTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174899
FBXO36 MISSION shRNA shRNA Plasmid DNA
F-box protein 36
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174899.4-690s21c1
Sequence:CCGGGTTGATGCGTGGAGCCATTTGCTCGAGCAAATGGCTCCACGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174899.4-306s21c1
Sequence:CCGGGAACGGCTCTCAGACGATTTGCTCGAGCAAATCGTCTGAGAGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174899.3-347s1c1
Sequence:CCGGCTTGAAGATATTGCCAGGCTTCTCGAGAAGCCTGGCAATATCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174899.3-182s1c1
Sequence:CCGGGAAACCCATGAAGACTTCCTACTCGAGTAGGAAGTCTTCATGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174899.3-218s1c1
Sequence:CCGGCAAGGTCAAACTGCCTTAATACTCGAGTATTAAGGCAGTTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174899.3-394s1c1
Sequence:CCGGGCTGTGCATGTCTGATAAACTCTCGAGAGTTTATCAGACATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174899.3-640s1c1
Sequence:CCGGCCAAATCTCTTCTGTCTCCTTCTCGAGAAGGAGACAGAAGAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174899.3-309s1c1
Sequence:CCGGCAGACGATTTGCTCCTGACTACTCGAGTAGTCAGGAGCAAATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174899.3-756s1c1
Sequence:CCGGCTTGCTAGAGTCACCGTCATTCTCGAGAATGACGGTGACTCTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174899
FBXO36 MISSION shRNA Lentiviral Transduction Particles
F-box protein 36
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174899.4-690s21c1
Sequence:CCGGGTTGATGCGTGGAGCCATTTGCTCGAGCAAATGGCTCCACGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174899.4-306s21c1
Sequence:CCGGGAACGGCTCTCAGACGATTTGCTCGAGCAAATCGTCTGAGAGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174899.3-347s1c1
Sequence:CCGGCTTGAAGATATTGCCAGGCTTCTCGAGAAGCCTGGCAATATCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174899.3-182s1c1
Sequence:CCGGGAAACCCATGAAGACTTCCTACTCGAGTAGGAAGTCTTCATGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174899.3-218s1c1
Sequence:CCGGCAAGGTCAAACTGCCTTAATACTCGAGTATTAAGGCAGTTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174899.3-394s1c1
Sequence:CCGGGCTGTGCATGTCTGATAAACTCTCGAGAGTTTATCAGACATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174899.3-640s1c1
Sequence:CCGGCCAAATCTCTTCTGTCTCCTTCTCGAGAAGGAGACAGAAGAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174899.3-309s1c1
Sequence:CCGGCAGACGATTTGCTCCTGACTACTCGAGTAGTCAGGAGCAAATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174899.3-756s1c1
Sequence:CCGGCTTGCTAGAGTCACCGTCATTCTCGAGAATGACGGTGACTCTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025386
VALIDATED
FBXO36 MISSION shRNA Bacterial Glycerol Stock
F-box protein 36
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025386.2-245s21c1
Sequence:CCGGCGCCGTAGTATTTGGTACAAACTCGAGTTTGTACCAAATACTACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025386.2-649s21c1
Sequence:CCGGCCAAAGCTCACTCTCTCTTAACTCGAGTTAAGAGAGAGTGAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025386.2-120s21c1
Sequence:CCGGCGGACTCAGATCATCTTTAGACTCGAGTCTAAAGATGATCTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025386.2-335s21c1
Sequence:CCGGGCTGCTGAAGATCATCTGCTACTCGAGTAGCAGATGATCTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025386.1-338s1c1
Sequence:CCGGGCTGAAGATCATCTGCTACCTCTCGAGAGGTAGCAGATGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-245s1c1
Sequence:CCGGCGCCGTAGTATTTGGTACAAACTCGAGTTTGTACCAAATACTACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-335s1c1
Sequence:CCGGGCTGCTGAAGATCATCTGCTACTCGAGTAGCAGATGATCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-649s1c1
Sequence:CCGGCCAAAGCTCACTCTCTCTTAACTCGAGTTAAGAGAGAGTGAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-120s1c1
Sequence:CCGGCGGACTCAGATCATCTTTAGACTCGAGTCTAAAGATGATCTGAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025386
VALIDATED
FBXO36 MISSION shRNA shRNA Plasmid DNA
F-box protein 36
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025386.2-245s21c1
Sequence:CCGGCGCCGTAGTATTTGGTACAAACTCGAGTTTGTACCAAATACTACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025386.2-649s21c1
Sequence:CCGGCCAAAGCTCACTCTCTCTTAACTCGAGTTAAGAGAGAGTGAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025386.2-120s21c1
Sequence:CCGGCGGACTCAGATCATCTTTAGACTCGAGTCTAAAGATGATCTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025386.2-335s21c1
Sequence:CCGGGCTGCTGAAGATCATCTGCTACTCGAGTAGCAGATGATCTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025386.1-338s1c1
Sequence:CCGGGCTGAAGATCATCTGCTACCTCTCGAGAGGTAGCAGATGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-245s1c1
Sequence:CCGGCGCCGTAGTATTTGGTACAAACTCGAGTTTGTACCAAATACTACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-335s1c1
Sequence:CCGGGCTGCTGAAGATCATCTGCTACTCGAGTAGCAGATGATCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-649s1c1
Sequence:CCGGCCAAAGCTCACTCTCTCTTAACTCGAGTTAAGAGAGAGTGAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-120s1c1
Sequence:CCGGCGGACTCAGATCATCTTTAGACTCGAGTCTAAAGATGATCTGAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025386
VALIDATED
FBXO36 MISSION shRNA Lentiviral Transduction Particles
F-box protein 36
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025386.2-245s21c1
Sequence:CCGGCGCCGTAGTATTTGGTACAAACTCGAGTTTGTACCAAATACTACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025386.2-649s21c1
Sequence:CCGGCCAAAGCTCACTCTCTCTTAACTCGAGTTAAGAGAGAGTGAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025386.2-120s21c1
Sequence:CCGGCGGACTCAGATCATCTTTAGACTCGAGTCTAAAGATGATCTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025386.2-335s21c1
Sequence:CCGGGCTGCTGAAGATCATCTGCTACTCGAGTAGCAGATGATCTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025386.1-338s1c1
Sequence:CCGGGCTGAAGATCATCTGCTACCTCTCGAGAGGTAGCAGATGATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-245s1c1
Sequence:CCGGCGCCGTAGTATTTGGTACAAACTCGAGTTTGTACCAAATACTACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-335s1c1
Sequence:CCGGGCTGCTGAAGATCATCTGCTACTCGAGTAGCAGATGATCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-649s1c1
Sequence:CCGGCCAAAGCTCACTCTCTCTTAACTCGAGTTAAGAGAGAGTGAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025386.1-120s1c1
Sequence:CCGGCGGACTCAGATCATCTTTAGACTCGAGTCTAAAGATGATCTGAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks