EMAIL THIS PAGE TO A FRIEND

FBXO38

F-box protein 38

104 Gene Product Result for
Synonyms: Fbx38 MOKA
Gene ID:
Mouse(107035) F-box protein 38
Rat(307390) F-box protein 38
Zebrafish(799091) F-box protein 38
cow(533554) F-box protein 38
Horse(100060728) F-box protein 38
domestic cat(101087203) F-box protein 38
dog(489199) F-box protein 38
chicken(416151) F-box protein 38
naked mole-rat(101707024) F-box protein 38
sheep(101117330) F-box protein 38
Domestic Rabbit(100340131) F-box protein 38
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024862 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084161 MISSION® esiRNA esiRNA human FBXO38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030793 Rosetta Predictions human pricing
NM_205836 Rosetta Predictions human pricing
NM_001107385 Rosetta Predictions rat pricing
NM_134136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211512 predicted 2865
2 SASI_Hs01_00211513 predicted 2847
3 SASI_Hs01_00211515 predicted 206
4 SASI_Hs01_00211516 predicted 1211
5 SASI_Hs02_00358345 predicted 3284
6 SASI_Hs01_00211517 predicted 1411
7 SASI_Hs01_00211518 predicted 776
8 SASI_Hs01_00211519 predicted 556
9 SASI_Hs02_00358346 predicted 262
10 SASI_Hs02_00358347 predicted 1378
11 SASI_Hs01_00211514 predicted 1056
12 SASI_Hs01_00211520 predicted 614
13 SASI_Hs01_00211521 predicted 3365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183885 predicted 3088
2 SASI_Hs01_00183886 predicted 3070
3 SASI_Hs01_00183889 predicted 1206
4 SASI_Hs02_00373461 predicted 3506
5 SASI_Hs01_00183890 predicted 1418
6 SASI_Hs01_00183891 predicted 775
7 SASI_Hs01_00183892 predicted 555
8 SASI_Hs02_00373462 predicted 3664
9 SASI_Hs02_00373463 predicted 254
10 SASI_Hs02_00373464 predicted 1385
11 SASI_Hs01_00183887 predicted 1047
12 SASI_Hs01_00183888 predicted 206
13 SASI_Hs01_00183893 predicted 613
14 SASI_Hs01_00183894 predicted 3598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228295 predicted 2159
2 SASI_Rn02_00228296 predicted 3767
3 SASI_Rn02_00228297 predicted 3011
4 SASI_Rn02_00228298 predicted 1959
5 SASI_Rn02_00228299 predicted 2781
6 SASI_Rn02_00228300 predicted 3507
7 SASI_Rn02_00228301 predicted 2253
8 SASI_Rn02_00228302 predicted 1991
9 SASI_Rn02_00228303 predicted 3118
10 SASI_Rn02_00228304 predicted 3837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074260 predicted 1180
2 SASI_Mm02_00339385 predicted 1397
3 SASI_Mm01_00074262 predicted 2811
4 SASI_Mm01_00074265 predicted 2974
5 SASI_Mm01_00074266 predicted 826
6 SASI_Mm02_00339386 predicted 1996
7 SASI_Mm01_00074268 predicted 3319
8 SASI_Mm01_00074269 predicted 1939
9 SASI_Mm02_00339387 predicted 1749
10 SASI_Mm02_00339388 predicted 3738
11 SASI_Mm01_00074261 predicted 1298
12 SASI_Mm01_00074263 predicted 1623
13 SASI_Mm01_00074264 predicted 3057
14 SASI_Mm01_00074267 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024862
FBXO38 MISSION shRNA Bacterial Glycerol Stock
F-box protein 38
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-503s1c1
Sequence:CCGGCCAAACTTAGTGGGTGTGGAACTCGAGTTCCACACCCACTAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-248s1c1
Sequence:CCGGGAATGTCTTTCCCGGAAGCTACTCGAGTAGCTTCCGGGAAAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-770s1c1
Sequence:CCGGGACTTCCTTTGTATCAGCTTACTCGAGTAAGCTGATACAAAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-784s1c1
Sequence:CCGGCAGCTTAAGAACTTTCGTCATCTCGAGATGACGAAAGTTCTTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-1043s1c1
Sequence:CCGGGCCCGTAGGTTACATGAAGTTCTCGAGAACTTCATGTAACCTACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024862
FBXO38 MISSION shRNA shRNA Plasmid DNA
F-box protein 38
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-503s1c1
Sequence:CCGGCCAAACTTAGTGGGTGTGGAACTCGAGTTCCACACCCACTAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-248s1c1
Sequence:CCGGGAATGTCTTTCCCGGAAGCTACTCGAGTAGCTTCCGGGAAAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-770s1c1
Sequence:CCGGGACTTCCTTTGTATCAGCTTACTCGAGTAAGCTGATACAAAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-784s1c1
Sequence:CCGGCAGCTTAAGAACTTTCGTCATCTCGAGATGACGAAAGTTCTTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-1043s1c1
Sequence:CCGGGCCCGTAGGTTACATGAAGTTCTCGAGAACTTCATGTAACCTACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024862
FBXO38 MISSION shRNA Lentiviral Transduction Particles
F-box protein 38
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-503s1c1
Sequence:CCGGCCAAACTTAGTGGGTGTGGAACTCGAGTTCCACACCCACTAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-248s1c1
Sequence:CCGGGAATGTCTTTCCCGGAAGCTACTCGAGTAGCTTCCGGGAAAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-770s1c1
Sequence:CCGGGACTTCCTTTGTATCAGCTTACTCGAGTAAGCTGATACAAAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-784s1c1
Sequence:CCGGCAGCTTAAGAACTTTCGTCATCTCGAGATGACGAAAGTTCTTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024862.1-1043s1c1
Sequence:CCGGGCCCGTAGGTTACATGAAGTTCTCGAGAACTTCATGTAACCTACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134136
VALIDATED
FBXO38 MISSION shRNA Bacterial Glycerol Stock
F-box protein 38
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.1-1341s1c1
Sequence:CCGGCCTGTATCAAATATCTGGCAACTCGAGTTGCCAGATATTTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.1-1342s1c1
Sequence:CCGGCTGTATCAAATATCTGGCAATCTCGAGATTGCCAGATATTTGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.1-2185s1c1
Sequence:CCGGGCAGATCAAAGCCGATATGAACTCGAGTTCATATCGGCTTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134136.3-1445s21c1
Sequence:CCGGGTGGATGCGACTGGTTGATATCTCGAGATATCAACCAGTCGCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.3-3350s1c1
Sequence:CCGGCATCAATCAAGAGCTCATTAACTCGAGTTAATGAGCTCTTGATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134136.3-4234s21c1
Sequence:CCGGGTGTTTATATTTGGCATATTCCTCGAGGAATATGCCAAATATAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134136.3-2812s21c1
Sequence:CCGGTGTCCCATGTACCGCTGATATCTCGAGATATCAGCGGTACATGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134136.3-675s21c1
Sequence:CCGGCGTAATCGTAACGGAGCATTTCTCGAGAAATGCTCCGTTACGATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134136.3-3350s21c1
Sequence:CCGGCATCAATCAAGAGCTCATTAACTCGAGTTAATGAGCTCTTGATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134136
VALIDATED
FBXO38 MISSION shRNA shRNA Plasmid DNA
F-box protein 38
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.1-1341s1c1
Sequence:CCGGCCTGTATCAAATATCTGGCAACTCGAGTTGCCAGATATTTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.1-1342s1c1
Sequence:CCGGCTGTATCAAATATCTGGCAATCTCGAGATTGCCAGATATTTGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.1-2185s1c1
Sequence:CCGGGCAGATCAAAGCCGATATGAACTCGAGTTCATATCGGCTTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134136.3-1445s21c1
Sequence:CCGGGTGGATGCGACTGGTTGATATCTCGAGATATCAACCAGTCGCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.3-3350s1c1
Sequence:CCGGCATCAATCAAGAGCTCATTAACTCGAGTTAATGAGCTCTTGATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134136.3-4234s21c1
Sequence:CCGGGTGTTTATATTTGGCATATTCCTCGAGGAATATGCCAAATATAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134136.3-2812s21c1
Sequence:CCGGTGTCCCATGTACCGCTGATATCTCGAGATATCAGCGGTACATGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134136.3-675s21c1
Sequence:CCGGCGTAATCGTAACGGAGCATTTCTCGAGAAATGCTCCGTTACGATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134136.3-3350s21c1
Sequence:CCGGCATCAATCAAGAGCTCATTAACTCGAGTTAATGAGCTCTTGATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134136
VALIDATED
FBXO38 MISSION shRNA Lentiviral Transduction Particles
F-box protein 38
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.1-1341s1c1
Sequence:CCGGCCTGTATCAAATATCTGGCAACTCGAGTTGCCAGATATTTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.1-1342s1c1
Sequence:CCGGCTGTATCAAATATCTGGCAATCTCGAGATTGCCAGATATTTGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.1-2185s1c1
Sequence:CCGGGCAGATCAAAGCCGATATGAACTCGAGTTCATATCGGCTTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134136.3-1445s21c1
Sequence:CCGGGTGGATGCGACTGGTTGATATCTCGAGATATCAACCAGTCGCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134136.3-3350s1c1
Sequence:CCGGCATCAATCAAGAGCTCATTAACTCGAGTTAATGAGCTCTTGATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134136.3-4234s21c1
Sequence:CCGGGTGTTTATATTTGGCATATTCCTCGAGGAATATGCCAAATATAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134136.3-2812s21c1
Sequence:CCGGTGTCCCATGTACCGCTGATATCTCGAGATATCAGCGGTACATGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134136.3-675s21c1
Sequence:CCGGCGTAATCGTAACGGAGCATTTCTCGAGAAATGCTCCGTTACGATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134136.3-3350s21c1
Sequence:CCGGCATCAATCAAGAGCTCATTAACTCGAGTTAATGAGCTCTTGATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks