EMAIL THIS PAGE TO A FRIEND

FBXO39

F-box protein 39

91 Gene Product Result for
Synonyms: Fbx39
UniProtKB ID: Q8N4B4
Gene ID:
Human(162517) Summary: Members of the F-box protein family, such as FBXO39, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(628100) F-box protein 39
Rat(303287) F-box protein 39
sheep(101103406) F-box protein 39
naked mole-rat(101703072) F-box protein 39
chicken(776097) F-box protein 39
dog(479466) F-box protein 39
cow(539103) F-box protein 39
domestic cat(101089221) F-box protein 39
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103738 Anti-FBXO39 antibody produced in rabbit affinity isolated antibody horse, rat, bovine, canine, human, mouse, guinea pig, rabbit
western blot pricing
SAB1306997 ANTI-FBXO39(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB2103550 Anti-FBXO39, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rabbit, guinea pig, human, bovine, canine, rat, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153230 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153230 Rosetta Predictions human pricing
NM_001039018 Rosetta Predictions rat pricing
NM_001099688 Rosetta Predictions mouse pricing
XM_892822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067456 predicted 864
2 SASI_Hs01_00067457 predicted 462
3 SASI_Hs01_00067458 predicted 373
4 SASI_Hs01_00067459 predicted 814
5 SASI_Hs01_00067460 predicted 661
6 SASI_Hs01_00067461 predicted 472
7 SASI_Hs01_00067462 predicted 1299
8 SASI_Hs02_00367094 predicted 1180
9 SASI_Hs01_00067463 predicted 585
10 SASI_Hs01_00067464 predicted 855
11 SASI_Hs01_00067455 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204748 predicted 239
2 SASI_Rn02_00204749 predicted 1114
3 SASI_Rn02_00204750 predicted 1083
4 SASI_Rn02_00204751 predicted 761
5 SASI_Rn02_00204752 predicted 690
6 SASI_Rn02_00204753 predicted 735
7 SASI_Rn02_00204754 predicted 1280
8 SASI_Rn02_00204755 predicted 512
9 SASI_Rn02_00204756 predicted 975
10 SASI_Rn02_00204757 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301985 predicted 294
2 SASI_Mm02_00301986 predicted 1378
3 SASI_Mm02_00301987 predicted 1454
4 SASI_Mm02_00301988 predicted 1034
5 SASI_Mm02_00301989 predicted 1384
6 SASI_Mm02_00301990 predicted 787
7 SASI_Mm02_00301991 predicted 841
8 SASI_Mm02_00301992 predicted 1359
9 SASI_Mm02_00301993 predicted 947
10 SASI_Mm02_00301994 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218060 predicted 1716
2 SASI_Mm01_00218061 predicted 1744
3 SASI_Mm01_00218062 predicted 1815
4 SASI_Mm01_00218063 predicted 1719
5 SASI_Mm01_00218064 predicted 1772
6 SASI_Mm01_00218065 predicted 1783
7 SASI_Mm01_00218066 predicted 1710
8 SASI_Mm01_00218067 predicted 1702
9 SASI_Mm01_00218068 predicted 1720
10 SASI_Mm01_00218069 predicted 1807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153230
FBXO39 MISSION shRNA Bacterial Glycerol Stock
F-box protein 39
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153230.2-710s21c1
Sequence:CCGGAGCTCAACATCGAGGACTATTCTCGAGAATAGTCCTCGATGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153230.2-1404s21c1
Sequence:CCGGCGAATCAGAGCTTAGCTATTTCTCGAGAAATAGCTAAGCTCTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153230.2-609s21c1
Sequence:CCGGCCTGGATTATCTCAACCTAAACTCGAGTTTAGGTTGAGATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-1033s1c1
Sequence:CCGGCAGTCTGAGAAGCTGCTATTTCTCGAGAAATAGCAGCTTCTCAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129014    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153230.1-1431s1c1
Sequence:CCGGGAGCACTCTACAGATGAAGAACTCGAGTTCTTCATCTGTAGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-820s1c1
Sequence:CCGGGCTTGAGAACTTGTGTGAGAACTCGAGTTCTCACACAAGTTCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-973s1c1
Sequence:CCGGGATCATGAAGTACGAACGCTTCTCGAGAAGCGTTCGTACTTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-553s1c1
Sequence:CCGGCAGCTTGAGCTTCTTCTTAAACTCGAGTTTAAGAAGAAGCTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-1288s1c1
Sequence:CCGGGCGTGTATTCAAGGCGAGAATCTCGAGATTCTCGCCTTGAATACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153230
FBXO39 MISSION shRNA shRNA Plasmid DNA
F-box protein 39
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153230.2-710s21c1
Sequence:CCGGAGCTCAACATCGAGGACTATTCTCGAGAATAGTCCTCGATGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153230.2-1404s21c1
Sequence:CCGGCGAATCAGAGCTTAGCTATTTCTCGAGAAATAGCTAAGCTCTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153230.2-609s21c1
Sequence:CCGGCCTGGATTATCTCAACCTAAACTCGAGTTTAGGTTGAGATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-1033s1c1
Sequence:CCGGCAGTCTGAGAAGCTGCTATTTCTCGAGAAATAGCAGCTTCTCAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129014    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153230.1-1431s1c1
Sequence:CCGGGAGCACTCTACAGATGAAGAACTCGAGTTCTTCATCTGTAGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-820s1c1
Sequence:CCGGGCTTGAGAACTTGTGTGAGAACTCGAGTTCTCACACAAGTTCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-973s1c1
Sequence:CCGGGATCATGAAGTACGAACGCTTCTCGAGAAGCGTTCGTACTTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-553s1c1
Sequence:CCGGCAGCTTGAGCTTCTTCTTAAACTCGAGTTTAAGAAGAAGCTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-1288s1c1
Sequence:CCGGGCGTGTATTCAAGGCGAGAATCTCGAGATTCTCGCCTTGAATACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153230
FBXO39 MISSION shRNA Lentiviral Transduction Particles
F-box protein 39
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153230.2-710s21c1
Sequence:CCGGAGCTCAACATCGAGGACTATTCTCGAGAATAGTCCTCGATGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153230.2-1404s21c1
Sequence:CCGGCGAATCAGAGCTTAGCTATTTCTCGAGAAATAGCTAAGCTCTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153230.2-609s21c1
Sequence:CCGGCCTGGATTATCTCAACCTAAACTCGAGTTTAGGTTGAGATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-1033s1c1
Sequence:CCGGCAGTCTGAGAAGCTGCTATTTCTCGAGAAATAGCAGCTTCTCAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129014    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153230.1-1431s1c1
Sequence:CCGGGAGCACTCTACAGATGAAGAACTCGAGTTCTTCATCTGTAGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-820s1c1
Sequence:CCGGGCTTGAGAACTTGTGTGAGAACTCGAGTTCTCACACAAGTTCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-973s1c1
Sequence:CCGGGATCATGAAGTACGAACGCTTCTCGAGAAGCGTTCGTACTTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-553s1c1
Sequence:CCGGCAGCTTGAGCTTCTTCTTAAACTCGAGTTTAAGAAGAAGCTCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153230.1-1288s1c1
Sequence:CCGGGCGTGTATTCAAGGCGAGAATCTCGAGATTCTCGCCTTGAATACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099688
FBXO39 MISSION shRNA Bacterial Glycerol Stock
F-box protein 39
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-398s21c1
Sequence:CCGGAGTCGGCACTGTGGTACATTACTCGAGTAATGTACCACAGTGCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099688.2-1529s21c1
Sequence:CCGGTAGATGCACTTTGAACCTGAACTCGAGTTCAGGTTCAAAGTGCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-1457s21c1
Sequence:CCGGTCGATTCAGAACTTAACTATTCTCGAGAATAGTTAAGTTCTGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-1414s21c1
Sequence:CCGGGACAGGACCCTACGGGAAATTCTCGAGAATTTCCCGTAGGGTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-926s21c1
Sequence:CCGGTCCGGACCATGAACATCAAATCTCGAGATTTGATGTTCATGGTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099688
FBXO39 MISSION shRNA shRNA Plasmid DNA
F-box protein 39
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-398s21c1
Sequence:CCGGAGTCGGCACTGTGGTACATTACTCGAGTAATGTACCACAGTGCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099688.2-1529s21c1
Sequence:CCGGTAGATGCACTTTGAACCTGAACTCGAGTTCAGGTTCAAAGTGCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-1457s21c1
Sequence:CCGGTCGATTCAGAACTTAACTATTCTCGAGAATAGTTAAGTTCTGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-1414s21c1
Sequence:CCGGGACAGGACCCTACGGGAAATTCTCGAGAATTTCCCGTAGGGTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-926s21c1
Sequence:CCGGTCCGGACCATGAACATCAAATCTCGAGATTTGATGTTCATGGTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099688
FBXO39 MISSION shRNA Lentiviral Transduction Particles
F-box protein 39
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-398s21c1
Sequence:CCGGAGTCGGCACTGTGGTACATTACTCGAGTAATGTACCACAGTGCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099688.2-1529s21c1
Sequence:CCGGTAGATGCACTTTGAACCTGAACTCGAGTTCAGGTTCAAAGTGCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-1457s21c1
Sequence:CCGGTCGATTCAGAACTTAACTATTCTCGAGAATAGTTAAGTTCTGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-1414s21c1
Sequence:CCGGGACAGGACCCTACGGGAAATTCTCGAGAATTTCCCGTAGGGTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099688.2-926s21c1
Sequence:CCGGTCCGGACCATGAACATCAAATCTCGAGATTTGATGTTCATGGTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks