EMAIL THIS PAGE TO A FRIEND

FBXO3

F-box protein 3

177 Gene Product Result for
Synonyms: FBA FBX3
UniProtKB ID: Q9UK99, B3KY16, D3DR05, Q86X90, Q9H0V2, Q9NUX2
Gene ID:
Human(26273) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants diverging at the 3' end. [provided by RefSeq, Jul 2008]
Mouse(57443) F-box protein 3
Rat(690634) F-box protein 3
Zebrafish(553731) F-box protein 3
chicken(429495) F-box protein 3
domestic cat(101092462) F-box protein 3
Horse(100059295) F-box protein 3
cow(534287) F-box protein 3
dog(475944) F-box protein 3
sheep(101102927) F-box protein 3
naked mole-rat(101711682) F-box protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012175 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012175 Rosetta Predictions human pricing
NM_033406 Rosetta Predictions human pricing
NM_001109606 Rosetta Predictions rat pricing
NM_020593 Rosetta Predictions mouse pricing
NM_212433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095168 predicted 619
2 SASI_Hs01_00095170 predicted 684
3 SASI_Hs01_00095172 predicted 879
4 SASI_Hs01_00095173 predicted 761
5 SASI_Hs01_00095174 predicted 512
6 SASI_Hs01_00095175 predicted 428
7 SASI_Hs01_00095176 predicted 501
8 SASI_Hs01_00095177 predicted 719
9 SASI_Hs02_00343783 predicted 513
10 SASI_Hs02_00343784 predicted 998
11 SASI_Hs01_00095169 predicted 877
12 SASI_Hs01_00095171 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077152 predicted 618
2 SASI_Hs01_00077154 predicted 684
3 SASI_Hs01_00077156 predicted 880
4 SASI_Hs01_00077157 predicted 766
5 SASI_Hs01_00077158 predicted 515
6 SASI_Hs01_00077159 predicted 427
7 SASI_Hs01_00077160 predicted 509
8 SASI_Hs01_00077161 predicted 713
9 SASI_Hs02_00361298 predicted 520
10 SASI_Hs02_00361299 predicted 997
11 SASI_Hs01_00077153 predicted 876
12 SASI_Hs01_00077155 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250027 predicted 723
2 SASI_Rn02_00250028 predicted 1132
3 SASI_Rn02_00250029 predicted 883
4 SASI_Rn02_00250030 predicted 1253
5 SASI_Rn02_00250031 predicted 1398
6 SASI_Rn02_00250032 predicted 273
7 SASI_Rn02_00250033 predicted 1243
8 SASI_Rn02_00250034 predicted 1230
9 SASI_Rn02_00250035 predicted 945
10 SASI_Rn02_00250036 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109153 predicted 729
2 SASI_Mm01_00109154 predicted 912
3 SASI_Mm01_00109155 predicted 861
4 SASI_Mm01_00109156 predicted 631
5 SASI_Mm01_00109157 predicted 809
6 SASI_Mm01_00109158 predicted 466
7 SASI_Mm01_00109159 predicted 569
8 SASI_Mm01_00109160 predicted 759
9 SASI_Mm01_00109161 predicted 904
10 SASI_Mm01_00109162 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159347 predicted 729
2 SASI_Mm01_00159348 predicted 910
3 SASI_Mm01_00159349 predicted 861
4 SASI_Mm01_00159350 predicted 629
5 SASI_Mm01_00159351 predicted 811
6 SASI_Mm01_00159352 predicted 465
7 SASI_Mm01_00159353 predicted 567
8 SASI_Mm01_00159354 predicted 763
9 SASI_Mm01_00159355 predicted 903
10 SASI_Mm01_00159356 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020593
FBXO3 MISSION shRNA Bacterial Glycerol Stock
F-box protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-174s21c1
Sequence:CCGGGCTATGTTAGTCGAAGACTTACTCGAGTAAGTCTTCGACTAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-480s21c1
Sequence:CCGGCGGATGATTATCGCTGTTCATCTCGAGATGAACAGCGATAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-709s21c1
Sequence:CCGGGCGGAATAAGAACGAAGTGTTCTCGAGAACACTTCGTTCTTATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-1100s21c1
Sequence:CCGGCCTGGAGTAGTCGGTGAATTTCTCGAGAAATTCACCGACTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-174s1c1
Sequence:CCGGGCTATGTTAGTCGAAGACTTACTCGAGTAAGTCTTCGACTAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-1100s1c1
Sequence:CCGGCCTGGAGTAGTCGGTGAATTTCTCGAGAAATTCACCGACTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-709s1c1
Sequence:CCGGGCGGAATAAGAACGAAGTGTTCTCGAGAACACTTCGTTCTTATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-480s1c1
Sequence:CCGGCGGATGATTATCGCTGTTCATCTCGAGATGAACAGCGATAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020593
FBXO3 MISSION shRNA shRNA Plasmid DNA
F-box protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-174s21c1
Sequence:CCGGGCTATGTTAGTCGAAGACTTACTCGAGTAAGTCTTCGACTAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-480s21c1
Sequence:CCGGCGGATGATTATCGCTGTTCATCTCGAGATGAACAGCGATAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-709s21c1
Sequence:CCGGGCGGAATAAGAACGAAGTGTTCTCGAGAACACTTCGTTCTTATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-1100s21c1
Sequence:CCGGCCTGGAGTAGTCGGTGAATTTCTCGAGAAATTCACCGACTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-174s1c1
Sequence:CCGGGCTATGTTAGTCGAAGACTTACTCGAGTAAGTCTTCGACTAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-1100s1c1
Sequence:CCGGCCTGGAGTAGTCGGTGAATTTCTCGAGAAATTCACCGACTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-709s1c1
Sequence:CCGGGCGGAATAAGAACGAAGTGTTCTCGAGAACACTTCGTTCTTATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-480s1c1
Sequence:CCGGCGGATGATTATCGCTGTTCATCTCGAGATGAACAGCGATAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020593
FBXO3 MISSION shRNA Lentiviral Transduction Particles
F-box protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-174s21c1
Sequence:CCGGGCTATGTTAGTCGAAGACTTACTCGAGTAAGTCTTCGACTAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-480s21c1
Sequence:CCGGCGGATGATTATCGCTGTTCATCTCGAGATGAACAGCGATAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-709s21c1
Sequence:CCGGGCGGAATAAGAACGAAGTGTTCTCGAGAACACTTCGTTCTTATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020593.2-1100s21c1
Sequence:CCGGCCTGGAGTAGTCGGTGAATTTCTCGAGAAATTCACCGACTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-174s1c1
Sequence:CCGGGCTATGTTAGTCGAAGACTTACTCGAGTAAGTCTTCGACTAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-1100s1c1
Sequence:CCGGCCTGGAGTAGTCGGTGAATTTCTCGAGAAATTCACCGACTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-709s1c1
Sequence:CCGGGCGGAATAAGAACGAAGTGTTCTCGAGAACACTTCGTTCTTATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020593.2-480s1c1
Sequence:CCGGCGGATGATTATCGCTGTTCATCTCGAGATGAACAGCGATAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012175
VALIDATED
FBXO3 MISSION shRNA Bacterial Glycerol Stock
F-box protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-815s1c1
Sequence:CCGGCCCATCATCAGAGACCAAATTCTCGAGAATTTGGTCTCTGATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-1573s1c1
Sequence:CCGGCCTGGGTTCTATGTGACACTACTCGAGTAGTGTCACATAGAACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012175.x-1134s1c1
Sequence:CCGGCATTCTCTACAACATCAGGATCTCGAGATCCTGATGTTGTAGAGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-289s1c1
Sequence:CCGGAGGAAGATACATTGACCATTACTCGAGTAATGGTCAATGTATCTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-522s1c1
Sequence:CCGGCACTGTCTAATCACTATCGTTCTCGAGAACGATAGTGATTAGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012175
VALIDATED
FBXO3 MISSION shRNA shRNA Plasmid DNA
F-box protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-815s1c1
Sequence:CCGGCCCATCATCAGAGACCAAATTCTCGAGAATTTGGTCTCTGATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-1573s1c1
Sequence:CCGGCCTGGGTTCTATGTGACACTACTCGAGTAGTGTCACATAGAACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012175.x-1134s1c1
Sequence:CCGGCATTCTCTACAACATCAGGATCTCGAGATCCTGATGTTGTAGAGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-289s1c1
Sequence:CCGGAGGAAGATACATTGACCATTACTCGAGTAATGGTCAATGTATCTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-522s1c1
Sequence:CCGGCACTGTCTAATCACTATCGTTCTCGAGAACGATAGTGATTAGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012175
VALIDATED
FBXO3 MISSION shRNA Lentiviral Transduction Particles
F-box protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-815s1c1
Sequence:CCGGCCCATCATCAGAGACCAAATTCTCGAGAATTTGGTCTCTGATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-1573s1c1
Sequence:CCGGCCTGGGTTCTATGTGACACTACTCGAGTAGTGTCACATAGAACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012175.x-1134s1c1
Sequence:CCGGCATTCTCTACAACATCAGGATCTCGAGATCCTGATGTTGTAGAGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-289s1c1
Sequence:CCGGAGGAAGATACATTGACCATTACTCGAGTAATGGTCAATGTATCTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012175.x-522s1c1
Sequence:CCGGCACTGTCTAATCACTATCGTTCTCGAGAACGATAGTGATTAGACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks