EMAIL THIS PAGE TO A FRIEND

FBXO41

F-box protein 41

191 Gene Product Result for
Synonyms: FBX41
UniProtKB ID: Q8TF61, G3V0Z7, Q2M1V8
Gene ID:
Human(150726) Summary: Members of the F-box protein family, such as FBXO41, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(330369) F-box protein 41
Rat(312504) F-box protein 41
Zebrafish(567804) F-box protein 41
chicken(428805) F-box protein 41
cow(536077) F-box protein 41
domestic cat(101098132) F-box protein 41
Horse(100059038) F-box protein 41
dog(483113) F-box protein 41
naked mole-rat(101706747) F-box protein 41
sheep(101104391) F-box protein 41
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080410 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080410 Rosetta Predictions human pricing
NM_001107871 Rosetta Predictions rat pricing
XM_242562 Rosetta Predictions rat pricing
NM_001001160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314576 predicted 2850
2 SASI_Hs02_00314577 predicted 1941
3 SASI_Hs02_00314578 predicted 3226
4 SASI_Hs02_00314579 predicted 2664
5 SASI_Hs02_00314580 predicted 2880
6 SASI_Hs02_00314581 predicted 1643
7 SASI_Hs02_00314582 predicted 2374
8 SASI_Hs02_00314583 predicted 2326
9 SASI_Hs02_00314584 predicted 2900
10 SASI_Hs02_00314585 predicted 2709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233105 predicted 2960
2 SASI_Rn02_00233106 predicted 2307
3 SASI_Rn02_00233107 predicted 3077
4 SASI_Rn02_00233108 predicted 1855
5 SASI_Rn02_00233109 predicted 1836
6 SASI_Rn02_00233110 predicted 3005
7 SASI_Rn02_00233111 predicted 2266
8 SASI_Rn02_00233112 predicted 3010
9 SASI_Rn02_00233113 predicted 2674
10 SASI_Rn02_00233114 predicted 3061
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_242562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126938 predicted 269
2 SASI_Rn01_00126939 predicted 1339
3 SASI_Rn01_00126940 predicted 1313
4 SASI_Rn01_00126941 predicted 1226
5 SASI_Rn01_00126942 predicted 576
6 SASI_Rn01_00126943 predicted 582
7 SASI_Rn01_00126944 predicted 989
8 SASI_Rn01_00126945 predicted 954
9 SASI_Rn01_00126946 predicted 261
10 SASI_Rn01_00126947 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195624 predicted 602
2 SASI_Mm01_00195625 predicted 2276
3 SASI_Mm01_00195626 predicted 3089
4 SASI_Mm01_00195627 predicted 3013
5 SASI_Mm01_00195629 predicted 2685
6 SASI_Mm02_00286075 predicted 2777
7 SASI_Mm01_00195630 predicted 2285
8 SASI_Mm01_00195631 predicted 1095
9 SASI_Mm01_00195632 predicted 2965
10 SASI_Mm01_00195633 predicted 2259
11 SASI_Mm01_00195628 predicted 1675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001160
FBXO41 MISSION shRNA Bacterial Glycerol Stock
F-box protein 41
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001160.1-4948s1c1
Sequence:CCGGGCTCTGAGTAAAGGTGAGTAACTCGAGTTACTCACCTTTACTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-551s1c1
Sequence:CCGGCCTTTCCAAGACCAACAGCATCTCGAGATGCTGTTGGTCTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-1545s1c1
Sequence:CCGGCCCGGCAGAATGCGAGAACATCTCGAGATGTTCTCGCATTCTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-2063s1c1
Sequence:CCGGCAGCCCAGAAATCCTCAAGATCTCGAGATCTTGAGGATTTCTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-2261s1c1
Sequence:CCGGCCAGGCTCACTCGTTAACATTCTCGAGAATGTTAACGAGTGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001160
FBXO41 MISSION shRNA shRNA Plasmid DNA
F-box protein 41
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001160.1-4948s1c1
Sequence:CCGGGCTCTGAGTAAAGGTGAGTAACTCGAGTTACTCACCTTTACTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-551s1c1
Sequence:CCGGCCTTTCCAAGACCAACAGCATCTCGAGATGCTGTTGGTCTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-1545s1c1
Sequence:CCGGCCCGGCAGAATGCGAGAACATCTCGAGATGTTCTCGCATTCTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-2063s1c1
Sequence:CCGGCAGCCCAGAAATCCTCAAGATCTCGAGATCTTGAGGATTTCTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-2261s1c1
Sequence:CCGGCCAGGCTCACTCGTTAACATTCTCGAGAATGTTAACGAGTGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001160
FBXO41 MISSION shRNA Lentiviral Transduction Particles
F-box protein 41
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001160.1-4948s1c1
Sequence:CCGGGCTCTGAGTAAAGGTGAGTAACTCGAGTTACTCACCTTTACTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-551s1c1
Sequence:CCGGCCTTTCCAAGACCAACAGCATCTCGAGATGCTGTTGGTCTTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-1545s1c1
Sequence:CCGGCCCGGCAGAATGCGAGAACATCTCGAGATGTTCTCGCATTCTGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-2063s1c1
Sequence:CCGGCAGCCCAGAAATCCTCAAGATCTCGAGATCTTGAGGATTTCTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001160.1-2261s1c1
Sequence:CCGGCCAGGCTCACTCGTTAACATTCTCGAGAATGTTAACGAGTGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080410
FBXO41 MISSION shRNA Bacterial Glycerol Stock
F-box protein 41
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-2072s21c1
Sequence:CCGGAGGAGAGCAAGGAGGAGTATGCTCGAGCATACTCCTCCTTGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-1952s21c1
Sequence:CCGGCAAGGGTGCTGCTTGAGAATGCTCGAGCATTCTCAAGCAGCACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-2640s21c1
Sequence:CCGGCCGGAACCTCAAGTCCATTGTCTCGAGACAATGGACTTGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-2665s21c1
Sequence:CCGGCAGATTGGGATTGCGGATTATCTCGAGATAATCCGCAATCCCAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080410.1-5160s21c1
Sequence:CCGGTCCCATGGGTTTGGCTATTTCCTCGAGGAAATAGCCAAACCCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080410
FBXO41 MISSION shRNA shRNA Plasmid DNA
F-box protein 41
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-2072s21c1
Sequence:CCGGAGGAGAGCAAGGAGGAGTATGCTCGAGCATACTCCTCCTTGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-1952s21c1
Sequence:CCGGCAAGGGTGCTGCTTGAGAATGCTCGAGCATTCTCAAGCAGCACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-2640s21c1
Sequence:CCGGCCGGAACCTCAAGTCCATTGTCTCGAGACAATGGACTTGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-2665s21c1
Sequence:CCGGCAGATTGGGATTGCGGATTATCTCGAGATAATCCGCAATCCCAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080410.1-5160s21c1
Sequence:CCGGTCCCATGGGTTTGGCTATTTCCTCGAGGAAATAGCCAAACCCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080410
FBXO41 MISSION shRNA Lentiviral Transduction Particles
F-box protein 41
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-2072s21c1
Sequence:CCGGAGGAGAGCAAGGAGGAGTATGCTCGAGCATACTCCTCCTTGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-1952s21c1
Sequence:CCGGCAAGGGTGCTGCTTGAGAATGCTCGAGCATTCTCAAGCAGCACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-2640s21c1
Sequence:CCGGCCGGAACCTCAAGTCCATTGTCTCGAGACAATGGACTTGAGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080410.1-2665s21c1
Sequence:CCGGCAGATTGGGATTGCGGATTATCTCGAGATAATCCGCAATCCCAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080410.1-5160s21c1
Sequence:CCGGTCCCATGGGTTTGGCTATTTCCTCGAGGAAATAGCCAAACCCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks