EMAIL THIS PAGE TO A FRIEND

FBXO42

F-box protein 42

114 Gene Product Result for
Synonyms: Fbx42 JFK
Gene ID:
Human(54455) Summary: Members of the F-box protein family, such as FBXO42, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (SKP1A; MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(213499) F-box protein 42
Rat(362646) F-box protein 42
sheep(101110912) F-box protein 42
naked mole-rat(101716264) F-box protein 42
Zebrafish(335459) F-box protein 42
chicken(419461) F-box protein 42
cow(527807) F-box protein 42
cow(100848477) F-box protein 42
Horse(100053402) F-box protein 42
domestic cat(101083438) F-box protein 42
dog(478219) F-box protein 42
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018994 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018994 Rosetta Predictions human pricing
NM_001108691 Rosetta Predictions rat pricing
NM_172518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352499 predicted 671
2 SASI_Hs01_00244805 predicted 2145
3 SASI_Hs01_00244806 predicted 1709
4 SASI_Hs01_00244807 predicted 1149
5 SASI_Hs01_00244808 predicted 1696
6 SASI_Hs01_00244809 predicted 262
7 SASI_Hs01_00244810 predicted 432
8 SASI_Hs01_00244811 predicted 740
9 SASI_Hs01_00244812 predicted 955
10 SASI_Hs02_00352500 predicted 1701
11 SASI_Hs01_00244804 predicted 2198
12 SASI_Hs01_00244813 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241125 predicted 473
2 SASI_Rn02_00241126 predicted 1146
3 SASI_Rn02_00241127 predicted 383
4 SASI_Rn02_00241128 predicted 520
5 SASI_Rn02_00241129 predicted 1389
6 SASI_Rn02_00241130 predicted 670
7 SASI_Rn02_00241131 predicted 852
8 SASI_Rn02_00241132 predicted 681
9 SASI_Rn02_00241133 predicted 557
10 SASI_Rn02_00241134 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053154 predicted 1745
2 SASI_Mm01_00053155 predicted 2239
3 SASI_Mm01_00053156 predicted 580
4 SASI_Mm01_00053157 predicted 2359
5 SASI_Mm01_00053158 predicted 479
6 SASI_Mm01_00053159 predicted 1798
7 SASI_Mm01_00053160 predicted 2168
8 SASI_Mm01_00053161 predicted 523
9 SASI_Mm02_00344116 predicted 820
10 SASI_Mm02_00344117 predicted 637
11 SASI_Mm01_00053152 predicted 364
12 SASI_Mm01_00053153 predicted 2194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018994
VALIDATED
FBXO42 MISSION shRNA Bacterial Glycerol Stock
F-box protein 42
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-1088s21c1
Sequence:CCGGTAGATGATGCAACTATCTTAACTCGAGTTAAGATAGTTGCATCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-441s21c1
Sequence:CCGGCAAACAGTGGTATCGACTTATCTCGAGATAAGTCGATACCACTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-474s21c1
Sequence:CCGGCCATCAGTGTTATCATGGTTTCTCGAGAAACCATGATAACACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018994.1-2501s21c1
Sequence:CCGGCACTCCAGGCTGGGATCAAATCTCGAGATTTGATCCCAGCCTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-576s21c1
Sequence:CCGGCTCGCACAGTGCATGCTATTACTCGAGTAATAGCATGCACTGTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018994.1-1150s1c1
Sequence:CCGGGCTTGGTTGTTGCACATGCATCTCGAGATGCATGTGCAACAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018994.1-1740s1c1
Sequence:CCGGCGCTTCCAGTAGTAATCCCATCTCGAGATGGGATTACTACTGGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018994.1-823s1c1
Sequence:CCGGCCAGAGAGATTCTTTGATGAACTCGAGTTCATCAAAGAATCTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018994.1-474s1c1
Sequence:CCGGCCATCAGTGTTATCATGGTTTCTCGAGAAACCATGATAACACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018994.1-1096s1c1
Sequence:CCGGGCAACTATCTTAATCCTCGGACTCGAGTCCGAGGATTAAGATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018994.1-2127s1c1
Sequence:CCGGGAGTATGAACTGCAAGCCCATCTCGAGATGGGCTTGCAGTTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018994.1-1627s1c1
Sequence:CCGGCCTGAAGGATACGACCTGAAACTCGAGTTTCAGGTCGTATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018994
VALIDATED
FBXO42 MISSION shRNA shRNA Plasmid DNA
F-box protein 42
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-1088s21c1
Sequence:CCGGTAGATGATGCAACTATCTTAACTCGAGTTAAGATAGTTGCATCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-441s21c1
Sequence:CCGGCAAACAGTGGTATCGACTTATCTCGAGATAAGTCGATACCACTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-474s21c1
Sequence:CCGGCCATCAGTGTTATCATGGTTTCTCGAGAAACCATGATAACACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018994.1-2501s21c1
Sequence:CCGGCACTCCAGGCTGGGATCAAATCTCGAGATTTGATCCCAGCCTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-576s21c1
Sequence:CCGGCTCGCACAGTGCATGCTATTACTCGAGTAATAGCATGCACTGTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018994.1-1150s1c1
Sequence:CCGGGCTTGGTTGTTGCACATGCATCTCGAGATGCATGTGCAACAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018994.1-1740s1c1
Sequence:CCGGCGCTTCCAGTAGTAATCCCATCTCGAGATGGGATTACTACTGGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018994.1-823s1c1
Sequence:CCGGCCAGAGAGATTCTTTGATGAACTCGAGTTCATCAAAGAATCTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018994.1-474s1c1
Sequence:CCGGCCATCAGTGTTATCATGGTTTCTCGAGAAACCATGATAACACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018994.1-1096s1c1
Sequence:CCGGGCAACTATCTTAATCCTCGGACTCGAGTCCGAGGATTAAGATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018994.1-2127s1c1
Sequence:CCGGGAGTATGAACTGCAAGCCCATCTCGAGATGGGCTTGCAGTTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018994.1-1627s1c1
Sequence:CCGGCCTGAAGGATACGACCTGAAACTCGAGTTTCAGGTCGTATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018994
VALIDATED
FBXO42 MISSION shRNA Lentiviral Transduction Particles
F-box protein 42
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-1088s21c1
Sequence:CCGGTAGATGATGCAACTATCTTAACTCGAGTTAAGATAGTTGCATCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-441s21c1
Sequence:CCGGCAAACAGTGGTATCGACTTATCTCGAGATAAGTCGATACCACTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-474s21c1
Sequence:CCGGCCATCAGTGTTATCATGGTTTCTCGAGAAACCATGATAACACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018994.1-2501s21c1
Sequence:CCGGCACTCCAGGCTGGGATCAAATCTCGAGATTTGATCCCAGCCTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018994.1-576s21c1
Sequence:CCGGCTCGCACAGTGCATGCTATTACTCGAGTAATAGCATGCACTGTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018994.1-1150s1c1
Sequence:CCGGGCTTGGTTGTTGCACATGCATCTCGAGATGCATGTGCAACAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018994.1-1740s1c1
Sequence:CCGGCGCTTCCAGTAGTAATCCCATCTCGAGATGGGATTACTACTGGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018994.1-823s1c1
Sequence:CCGGCCAGAGAGATTCTTTGATGAACTCGAGTTCATCAAAGAATCTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018994.1-474s1c1
Sequence:CCGGCCATCAGTGTTATCATGGTTTCTCGAGAAACCATGATAACACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018994.1-1096s1c1
Sequence:CCGGGCAACTATCTTAATCCTCGGACTCGAGTCCGAGGATTAAGATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018994.1-2127s1c1
Sequence:CCGGGAGTATGAACTGCAAGCCCATCTCGAGATGGGCTTGCAGTTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018994.1-1627s1c1
Sequence:CCGGCCTGAAGGATACGACCTGAAACTCGAGTTTCAGGTCGTATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172518
VALIDATED
FBXO42 MISSION shRNA Bacterial Glycerol Stock
F-box protein 42
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172518.2-729s21c1
Sequence:CCGGCCTAAATAGCAAGGAGTGGATCTCGAGATCCACTCCTTGCTATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172518.2-2544s21c1
Sequence:CCGGTTGCTCCAGGCTGGGATTAAACTCGAGTTTAATCCCAGCCTGGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172518.2-2208s21c1
Sequence:CCGGGCTAGACATTAAAGACACCAACTCGAGTTGGTGTCTTTAATGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172518.2-895s21c1
Sequence:CCGGCACACGTACTCGCCGTCTAAACTCGAGTTTAGACGGCGAGTACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172518.2-2317s21c1
Sequence:CCGGCGAGGCGAGCTCATCGTATTTCTCGAGAAATACGATGAGCTCGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-729s1c1
Sequence:CCGGCCTAAATAGCAAGGAGTGGATCTCGAGATCCACTCCTTGCTATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172518.2-4396s1c1
Sequence:CCGGCCTGAAAGTTAAGAATCTCTACTCGAGTAGAGATTCTTAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-646s1c1
Sequence:CCGGGATGCCAATCAGTCTATGTATCTCGAGATACATAGACTGATTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-2208s1c1
Sequence:CCGGGCTAGACATTAAAGACACCAACTCGAGTTGGTGTCTTTAATGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-1574s1c1
Sequence:CCGGCCATTCTCAATGGTGGAAATTCTCGAGAATTTCCACCATTGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172518
VALIDATED
FBXO42 MISSION shRNA shRNA Plasmid DNA
F-box protein 42
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172518.2-729s21c1
Sequence:CCGGCCTAAATAGCAAGGAGTGGATCTCGAGATCCACTCCTTGCTATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172518.2-2544s21c1
Sequence:CCGGTTGCTCCAGGCTGGGATTAAACTCGAGTTTAATCCCAGCCTGGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172518.2-2208s21c1
Sequence:CCGGGCTAGACATTAAAGACACCAACTCGAGTTGGTGTCTTTAATGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172518.2-895s21c1
Sequence:CCGGCACACGTACTCGCCGTCTAAACTCGAGTTTAGACGGCGAGTACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172518.2-2317s21c1
Sequence:CCGGCGAGGCGAGCTCATCGTATTTCTCGAGAAATACGATGAGCTCGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-729s1c1
Sequence:CCGGCCTAAATAGCAAGGAGTGGATCTCGAGATCCACTCCTTGCTATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172518.2-4396s1c1
Sequence:CCGGCCTGAAAGTTAAGAATCTCTACTCGAGTAGAGATTCTTAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-646s1c1
Sequence:CCGGGATGCCAATCAGTCTATGTATCTCGAGATACATAGACTGATTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-2208s1c1
Sequence:CCGGGCTAGACATTAAAGACACCAACTCGAGTTGGTGTCTTTAATGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-1574s1c1
Sequence:CCGGCCATTCTCAATGGTGGAAATTCTCGAGAATTTCCACCATTGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172518
VALIDATED
FBXO42 MISSION shRNA Lentiviral Transduction Particles
F-box protein 42
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172518.2-729s21c1
Sequence:CCGGCCTAAATAGCAAGGAGTGGATCTCGAGATCCACTCCTTGCTATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172518.2-2544s21c1
Sequence:CCGGTTGCTCCAGGCTGGGATTAAACTCGAGTTTAATCCCAGCCTGGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172518.2-2208s21c1
Sequence:CCGGGCTAGACATTAAAGACACCAACTCGAGTTGGTGTCTTTAATGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172518.2-895s21c1
Sequence:CCGGCACACGTACTCGCCGTCTAAACTCGAGTTTAGACGGCGAGTACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172518.2-2317s21c1
Sequence:CCGGCGAGGCGAGCTCATCGTATTTCTCGAGAAATACGATGAGCTCGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-729s1c1
Sequence:CCGGCCTAAATAGCAAGGAGTGGATCTCGAGATCCACTCCTTGCTATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172518.2-4396s1c1
Sequence:CCGGCCTGAAAGTTAAGAATCTCTACTCGAGTAGAGATTCTTAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-646s1c1
Sequence:CCGGGATGCCAATCAGTCTATGTATCTCGAGATACATAGACTGATTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-2208s1c1
Sequence:CCGGGCTAGACATTAAAGACACCAACTCGAGTTGGTGTCTTTAATGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172518.2-1574s1c1
Sequence:CCGGCCATTCTCAATGGTGGAAATTCTCGAGAATTTCCACCATTGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks