EMAIL THIS PAGE TO A FRIEND

FBXO43

F-box protein 43

85 Gene Product Result for
Synonyms: EMI2 ERP1 FBX43
UniProtKB ID: Q4G163
Gene ID:
Human(286151) Summary: Members of the F-box protein family, such as FBXO43, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(78803) F-box protein 43
Rat(315034) F-box protein 43
Zebrafish(393403) F-box protein 43
chicken(420245) F-box protein 43
dog(481982) F-box protein 43
Horse(100055861) F-box protein 43
cow(540145) F-box protein 43
domestic cat(101082209) F-box protein 43
naked mole-rat(101712381) F-box protein 43
sheep(101105083) F-box protein 43
Domestic Rabbit(100340900) F-box protein 43
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001029860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029860 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029860 Rosetta Predictions human pricing
NM_001077528 Rosetta Predictions human pricing
XM_001059120 Rosetta Predictions rat pricing
XM_576249 Rosetta Predictions rat pricing
NM_001081253 Rosetta Predictions mouse pricing
XM_619315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307536 predicted 2552
2 SASI_Hs01_00063546 predicted 1130
3 SASI_Hs01_00063547 predicted 1047
4 SASI_Hs02_00307537 predicted 2863
5 SASI_Hs01_00063549 predicted 1457
6 SASI_Hs02_00307538 predicted 2722
7 SASI_Hs01_00063550 predicted 1510
8 SASI_Hs01_00063553 predicted 1869
9 SASI_Hs02_00307539 predicted 1912
10 SASI_Hs01_00063555 predicted 1438
11 SASI_Hs01_00063548 predicted 369
12 SASI_Hs01_00063551 predicted 571
13 SASI_Hs01_00063552 predicted 1230
14 SASI_Hs01_00063554 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312974 predicted 2595
2 SASI_Hs02_00312975 predicted 1173
3 SASI_Hs02_00312976 predicted 1088
4 SASI_Hs02_00312977 predicted 2914
5 SASI_Hs02_00312978 predicted 1504
6 SASI_Hs02_00312979 predicted 2773
7 SASI_Hs02_00312980 predicted 1551
8 SASI_Hs02_00312981 predicted 1916
9 SASI_Hs02_00312982 predicted 1953
10 SASI_Hs02_00312983 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292055 predicted 603
2 SASI_Rn02_00292056 predicted 1052
3 SASI_Rn02_00292057 predicted 2082
4 SASI_Rn02_00292058 predicted 901
5 SASI_Rn02_00292059 predicted 1640
6 SASI_Rn02_00292060 predicted 1442
7 SASI_Rn02_00292061 predicted 2053
8 SASI_Rn02_00292062 predicted 792
9 SASI_Rn02_00292063 predicted 2347
10 SASI_Rn02_00292064 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404937 predicted 414
2 SASI_Rn02_00404938 predicted 418
3 SASI_Rn02_00404939 predicted 404
4 SASI_Rn02_00404940 predicted 420
5 SASI_Rn02_00404941 predicted 442
6 SASI_Rn02_00404942 predicted 377
7 SASI_Rn02_00404943 predicted 404
8 SASI_Rn02_00404944 predicted 403
9 SASI_Rn02_00404945 predicted 412
10 SASI_Rn02_00404946 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296667 predicted 707
2 SASI_Mm02_00296668 predicted 2259
3 SASI_Mm02_00296669 predicted 1786
4 SASI_Mm02_00296670 predicted 962
5 SASI_Mm02_00296671 predicted 618
6 SASI_Mm02_00296672 predicted 2517
7 SASI_Mm02_00296673 predicted 1623
8 SASI_Mm02_00296674 predicted 801
9 SASI_Mm02_00296675 predicted 1821
10 SASI_Mm02_00296676 predicted 2321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224048 predicted 716
2 SASI_Mm01_00224049 predicted 705
3 SASI_Mm01_00224050 predicted 1233
4 SASI_Mm01_00224051 predicted 2266
5 SASI_Mm01_00224052 predicted 959
6 SASI_Mm01_00224053 predicted 621
7 SASI_Mm01_00224054 predicted 2178
8 SASI_Mm01_00224055 predicted 808
9 SASI_Mm01_00224056 predicted 1008
10 SASI_Mm01_00224057 predicted 2331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175281
FBXO43 MISSION shRNA Bacterial Glycerol Stock
F-box protein 43
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-1997s1c1
Sequence:CCGGCGGAGTAAACAGGAACAGTATCTCGAGATACTGTTCCTGTTTACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-787s1c1
Sequence:CCGGCCCATTAGTTACCAGCACGATCTCGAGATCGTGCTGGTAACTAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-1704s1c1
Sequence:CCGGCGGAGAGTTTATACAGTGCTTCTCGAGAAGCACTGTATAAACTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-1368s1c1
Sequence:CCGGCGGTCCATCCTAACTCTGATTCTCGAGAATCAGAGTTAGGATGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-717s1c1
Sequence:CCGGGCCAAGGTGTTAGCCTAGAAACTCGAGTTTCTAGGCTAACACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175281
FBXO43 MISSION shRNA shRNA Plasmid DNA
F-box protein 43
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-1997s1c1
Sequence:CCGGCGGAGTAAACAGGAACAGTATCTCGAGATACTGTTCCTGTTTACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-787s1c1
Sequence:CCGGCCCATTAGTTACCAGCACGATCTCGAGATCGTGCTGGTAACTAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-1704s1c1
Sequence:CCGGCGGAGAGTTTATACAGTGCTTCTCGAGAAGCACTGTATAAACTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-1368s1c1
Sequence:CCGGCGGTCCATCCTAACTCTGATTCTCGAGAATCAGAGTTAGGATGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-717s1c1
Sequence:CCGGGCCAAGGTGTTAGCCTAGAAACTCGAGTTTCTAGGCTAACACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175281
FBXO43 MISSION shRNA Lentiviral Transduction Particles
F-box protein 43
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-1997s1c1
Sequence:CCGGCGGAGTAAACAGGAACAGTATCTCGAGATACTGTTCCTGTTTACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-787s1c1
Sequence:CCGGCCCATTAGTTACCAGCACGATCTCGAGATCGTGCTGGTAACTAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-1704s1c1
Sequence:CCGGCGGAGAGTTTATACAGTGCTTCTCGAGAAGCACTGTATAAACTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-1368s1c1
Sequence:CCGGCGGTCCATCCTAACTCTGATTCTCGAGAATCAGAGTTAGGATGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175281.1-717s1c1
Sequence:CCGGGCCAAGGTGTTAGCCTAGAAACTCGAGTTTCTAGGCTAACACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029860
FBXO43 MISSION shRNA Bacterial Glycerol Stock
F-box protein 43
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.1-662s1c1
Sequence:CCGGGCTTAACACATCCTTTAGAATCTCGAGATTCTAAAGGATGTGTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.1-1917s1c1
Sequence:CCGGCGTGAAATTGTTGTTCAAGATCTCGAGATCTTGAACAACAATTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.1-863s1c1
Sequence:CCGGGCCAAGTTATCAACTTAGAAACTCGAGTTTCTAAGTTGATAACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029860.2-2652s21c1
Sequence:CCGGGCTAAGTACCAGCCATATAAGCTCGAGCTTATATGGCTGGTACTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.2-2808s1c1
Sequence:CCGGGCCCAGAGTAAGCGGAATTTACTCGAGTAAATTCCGCTTACTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029860.2-2929s1c1
Sequence:CCGGTAATGACAGGTGATGATTAATCTCGAGATTAATCATCACCTGTCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029860.2-1631s21c1
Sequence:CCGGTGTGGCAAACATTAGATTTAACTCGAGTTAAATCTAATGTTTGCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029860.2-2198s21c1
Sequence:CCGGGGACATCTTAACAGAATTAAACTCGAGTTTAATTCTGTTAAGATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029860
FBXO43 MISSION shRNA shRNA Plasmid DNA
F-box protein 43
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.1-662s1c1
Sequence:CCGGGCTTAACACATCCTTTAGAATCTCGAGATTCTAAAGGATGTGTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.1-1917s1c1
Sequence:CCGGCGTGAAATTGTTGTTCAAGATCTCGAGATCTTGAACAACAATTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.1-863s1c1
Sequence:CCGGGCCAAGTTATCAACTTAGAAACTCGAGTTTCTAAGTTGATAACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029860.2-2652s21c1
Sequence:CCGGGCTAAGTACCAGCCATATAAGCTCGAGCTTATATGGCTGGTACTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.2-2808s1c1
Sequence:CCGGGCCCAGAGTAAGCGGAATTTACTCGAGTAAATTCCGCTTACTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029860.2-2929s1c1
Sequence:CCGGTAATGACAGGTGATGATTAATCTCGAGATTAATCATCACCTGTCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029860.2-1631s21c1
Sequence:CCGGTGTGGCAAACATTAGATTTAACTCGAGTTAAATCTAATGTTTGCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029860.2-2198s21c1
Sequence:CCGGGGACATCTTAACAGAATTAAACTCGAGTTTAATTCTGTTAAGATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029860
FBXO43 MISSION shRNA Lentiviral Transduction Particles
F-box protein 43
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.1-662s1c1
Sequence:CCGGGCTTAACACATCCTTTAGAATCTCGAGATTCTAAAGGATGTGTTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.1-1917s1c1
Sequence:CCGGCGTGAAATTGTTGTTCAAGATCTCGAGATCTTGAACAACAATTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.1-863s1c1
Sequence:CCGGGCCAAGTTATCAACTTAGAAACTCGAGTTTCTAAGTTGATAACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029860.2-2652s21c1
Sequence:CCGGGCTAAGTACCAGCCATATAAGCTCGAGCTTATATGGCTGGTACTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029860.2-2808s1c1
Sequence:CCGGGCCCAGAGTAAGCGGAATTTACTCGAGTAAATTCCGCTTACTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029860.2-2929s1c1
Sequence:CCGGTAATGACAGGTGATGATTAATCTCGAGATTAATCATCACCTGTCATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029860.2-1631s21c1
Sequence:CCGGTGTGGCAAACATTAGATTTAACTCGAGTTAAATCTAATGTTTGCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029860.2-2198s21c1
Sequence:CCGGGGACATCTTAACAGAATTAAACTCGAGTTTAATTCTGTTAAGATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)