EMAIL THIS PAGE TO A FRIEND

FBXO44

F-box protein 44

95 Gene Product Result for
Synonyms: FBG3 FBX30 FBX6A Fbx44 Fbxo6a
Gene ID:
Human(93611) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It is also a member of the NFB42 (neural F Box 42 kDa) family, similar to F-box only protein 2 and F-box only protein 6. Four alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(230903) F-box protein 44
Rat(500587) F-box protein 44
sheep(101112585) F-box protein 44
naked mole-rat(101722747) F-box protein 44
Zebrafish(494034) F-box protein 44
cow(785057) F-box protein 44
domestic cat(101099387) F-box protein 44
dog(487445) F-box protein 44
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033182 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014765 Rosetta Predictions human pricing
NM_033182 Rosetta Predictions human pricing
NM_183412 Rosetta Predictions human pricing
NM_183413 Rosetta Predictions human pricing
XM_001074239 Rosetta Predictions rat pricing
XM_575958 Rosetta Predictions rat pricing
NM_173401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031849 predicted 1646
2 SASI_Hs02_00306562 predicted 1579
3 SASI_Hs01_00031850 predicted 1446
4 SASI_Hs01_00031848 predicted 1616
5 SASI_Hs01_00031851 predicted 1293
6 SASI_Hs01_00031852 predicted 994
7 SASI_Hs01_00031853 predicted 785
8 SASI_Hs01_00031854 predicted 961
9 SASI_Hs01_00031855 predicted 792
10 SASI_Hs01_00031856 predicted 846
11 SASI_Hs01_00031857 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027377 predicted 1279
2 SASI_Hs02_00360964 predicted 1211
3 SASI_Hs01_00027378 predicted 1082
4 SASI_Hs01_00027376 predicted 1235
5 SASI_Hs01_00027379 predicted 927
6 SASI_Hs01_00027380 predicted 621
7 SASI_Hs01_00027381 predicted 405
8 SASI_Hs01_00027382 predicted 584
9 SASI_Hs01_00027383 predicted 420
10 SASI_Hs01_00027384 predicted 473
11 SASI_Hs01_00027385 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233392 predicted 1258
2 SASI_Hs02_00371309 predicted 1196
3 SASI_Hs01_00233393 predicted 1062
4 SASI_Hs01_00233391 predicted 1229
5 SASI_Hs01_00233394 predicted 909
6 SASI_Hs01_00233395 predicted 607
7 SASI_Hs01_00233396 predicted 596
8 SASI_Hs01_00233397 predicted 517
9 SASI_Hs01_00233398 predicted 531
10 SASI_Hs01_00233399 predicted 1062
11 SASI_Hs01_00233400 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080025 predicted 1149
2 SASI_Hs02_00371310 predicted 1084
3 SASI_Hs01_00080026 predicted 956
4 SASI_Hs01_00080024 predicted 1115
5 SASI_Hs01_00080027 predicted 797
6 SASI_Hs01_00080028 predicted 494
7 SASI_Hs01_00080029 predicted 478
8 SASI_Hs01_00080030 predicted 410
9 SASI_Hs01_00080031 predicted 419
10 SASI_Hs01_00080032 predicted 956
11 SASI_Hs01_00080033 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345531 predicted 1062
2 SASI_Rn02_00345532 predicted 1374
3 SASI_Rn02_00345533 predicted 1299
4 SASI_Rn02_00345534 predicted 1371
5 SASI_Rn02_00345535 predicted 1247
6 SASI_Rn02_00345536 predicted 1120
7 SASI_Rn02_00345537 predicted 432
8 SASI_Rn02_00345538 predicted 1513
9 SASI_Rn02_00345539 predicted 1003
10 SASI_Rn02_00345540 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404567 predicted 576
2 SASI_Rn02_00404568 predicted 1068
3 SASI_Rn02_00404569 predicted 659
4 SASI_Rn02_00404570 predicted 1139
5 SASI_Rn02_00404571 predicted 456
6 SASI_Rn02_00404572 predicted 393
7 SASI_Rn02_00404573 predicted 467
8 SASI_Rn02_00404574 predicted 295
9 SASI_Rn02_00404575 predicted 886
10 SASI_Rn02_00404576 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024328 predicted 1129
2 SASI_Mm01_00024329 predicted 1133
3 SASI_Mm01_00024330 predicted 513
4 SASI_Mm01_00024331 predicted 1390
5 SASI_Mm01_00024332 predicted 464
6 SASI_Mm01_00024333 predicted 775
7 SASI_Mm01_00024335 predicted 964
8 SASI_Mm02_00345258 predicted 1156
9 SASI_Mm01_00024336 predicted 1141
10 SASI_Mm02_00345259 predicted 288
11 SASI_Mm01_00024334 predicted 525
12 SASI_Mm01_00024337 predicted 957
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033182
FBXO44 MISSION shRNA Bacterial Glycerol Stock
F-box protein 44
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-642s21c1
Sequence:CCGGCAAGTACCAGCTGTGCGTTCACTCGAGTGAACGCACAGCTGGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033182.5-1084s21c1
Sequence:CCGGCGAAAGGTCTTGACCTGAATGCTCGAGCATTCAGGTCAAGACCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-783s21c1
Sequence:CCGGCGTCCGCTACATCTGGTTTCACTCGAGTGAAACCAGATGTAGCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-404s21c1
Sequence:CCGGTCTGGAGCCTGGATGTGAATGCTCGAGCATTCACATCCAGGCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-546s21c1
Sequence:CCGGCCTCAAGGCCGAAGGGTATTGCTCGAGCAATACCCTTCGGCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033182.4-2224s1c1
Sequence:CCGGGCCAACAGCTTTACGGACATTCTCGAGAATGTCCGTAAAGCTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033182.4-474s1c1
Sequence:CCGGAGGTCAAGAAATACTTCGTTACTCGAGTAACGAAGTATTTCTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033182.4-464s1c1
Sequence:CCGGCCCAATGACCAGGTCAAGAAACTCGAGTTTCTTGACCTGGTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033182.4-739s1c1
Sequence:CCGGCTCCCACACATTCTCCAACTACTCGAGTAGTTGGAGAATGTGTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033182
FBXO44 MISSION shRNA shRNA Plasmid DNA
F-box protein 44
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-642s21c1
Sequence:CCGGCAAGTACCAGCTGTGCGTTCACTCGAGTGAACGCACAGCTGGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033182.5-1084s21c1
Sequence:CCGGCGAAAGGTCTTGACCTGAATGCTCGAGCATTCAGGTCAAGACCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-783s21c1
Sequence:CCGGCGTCCGCTACATCTGGTTTCACTCGAGTGAAACCAGATGTAGCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-404s21c1
Sequence:CCGGTCTGGAGCCTGGATGTGAATGCTCGAGCATTCACATCCAGGCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-546s21c1
Sequence:CCGGCCTCAAGGCCGAAGGGTATTGCTCGAGCAATACCCTTCGGCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033182.4-2224s1c1
Sequence:CCGGGCCAACAGCTTTACGGACATTCTCGAGAATGTCCGTAAAGCTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033182.4-474s1c1
Sequence:CCGGAGGTCAAGAAATACTTCGTTACTCGAGTAACGAAGTATTTCTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033182.4-464s1c1
Sequence:CCGGCCCAATGACCAGGTCAAGAAACTCGAGTTTCTTGACCTGGTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033182.4-739s1c1
Sequence:CCGGCTCCCACACATTCTCCAACTACTCGAGTAGTTGGAGAATGTGTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033182
FBXO44 MISSION shRNA Lentiviral Transduction Particles
F-box protein 44
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-642s21c1
Sequence:CCGGCAAGTACCAGCTGTGCGTTCACTCGAGTGAACGCACAGCTGGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033182.5-1084s21c1
Sequence:CCGGCGAAAGGTCTTGACCTGAATGCTCGAGCATTCAGGTCAAGACCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-783s21c1
Sequence:CCGGCGTCCGCTACATCTGGTTTCACTCGAGTGAAACCAGATGTAGCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-404s21c1
Sequence:CCGGTCTGGAGCCTGGATGTGAATGCTCGAGCATTCACATCCAGGCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033182.5-546s21c1
Sequence:CCGGCCTCAAGGCCGAAGGGTATTGCTCGAGCAATACCCTTCGGCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033182.4-2224s1c1
Sequence:CCGGGCCAACAGCTTTACGGACATTCTCGAGAATGTCCGTAAAGCTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033182.4-474s1c1
Sequence:CCGGAGGTCAAGAAATACTTCGTTACTCGAGTAACGAAGTATTTCTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033182.4-464s1c1
Sequence:CCGGCCCAATGACCAGGTCAAGAAACTCGAGTTTCTTGACCTGGTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033182.4-739s1c1
Sequence:CCGGCTCCCACACATTCTCCAACTACTCGAGTAGTTGGAGAATGTGTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173401
FBXO44 MISSION shRNA Bacterial Glycerol Stock
F-box protein 44
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173401.1-1164s1c1
Sequence:CCGGGCTTGCCTAGACCTGTTTCTACTCGAGTAGAAACAGGTCTAGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-463s1c1
Sequence:CCGGCGATGAATGGAAGGTAGAGGACTCGAGTCCTCTACCTTCCATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-742s1c1
Sequence:CCGGCCCGGTGATGATTCAGCAGAACTCGAGTTCTGCTGAATCATCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-202s1c1
Sequence:CCGGGCTGGAACTGTTCATCCACATCTCGAGATGTGGATGAACAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-413s1c1
Sequence:CCGGCCTTGTGCTGAAGAGGGATTTCTCGAGAAATCCCTCTTCAGCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173401
FBXO44 MISSION shRNA shRNA Plasmid DNA
F-box protein 44
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173401.1-1164s1c1
Sequence:CCGGGCTTGCCTAGACCTGTTTCTACTCGAGTAGAAACAGGTCTAGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-463s1c1
Sequence:CCGGCGATGAATGGAAGGTAGAGGACTCGAGTCCTCTACCTTCCATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-742s1c1
Sequence:CCGGCCCGGTGATGATTCAGCAGAACTCGAGTTCTGCTGAATCATCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-202s1c1
Sequence:CCGGGCTGGAACTGTTCATCCACATCTCGAGATGTGGATGAACAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-413s1c1
Sequence:CCGGCCTTGTGCTGAAGAGGGATTTCTCGAGAAATCCCTCTTCAGCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173401
FBXO44 MISSION shRNA Lentiviral Transduction Particles
F-box protein 44
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173401.1-1164s1c1
Sequence:CCGGGCTTGCCTAGACCTGTTTCTACTCGAGTAGAAACAGGTCTAGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-463s1c1
Sequence:CCGGCGATGAATGGAAGGTAGAGGACTCGAGTCCTCTACCTTCCATTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-742s1c1
Sequence:CCGGCCCGGTGATGATTCAGCAGAACTCGAGTTCTGCTGAATCATCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-202s1c1
Sequence:CCGGGCTGGAACTGTTCATCCACATCTCGAGATGTGGATGAACAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173401.1-413s1c1
Sequence:CCGGCCTTGTGCTGAAGAGGGATTTCTCGAGAAATCCCTCTTCAGCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks