EMAIL THIS PAGE TO A FRIEND

FBXO45

F-box protein 45

52 Gene Product Result for
Synonyms: Fbx45
UniProtKB ID: P0C2W1, A6NF90, D3DXB5
Gene ID:
Human(200933) Summary: Members of the F-box protein family, such as FBXO45, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (summary by Jin et al., 2004 [PubMed 15520277]
Mouse(268882) F-box protein 45
Zebrafish(393567) F-box protein 45
chicken(770111) F-box protein 45
cow(533064) F-box protein 45
domestic cat(101081828) F-box protein 45
dog(488031) F-box protein 45
naked mole-rat(101708452) F-box protein 45
sheep(101123179) F-box protein 45
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040730 Anti-FBXO45 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001105573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105573 Rosetta Predictions human pricing
XM_117294 Rosetta Predictions human pricing
XM_931557 Rosetta Predictions human pricing
NM_173439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324531 predicted 1028
2 SASI_Hs02_00324532 predicted 946
3 SASI_Hs02_00324533 predicted 829
4 SASI_Hs02_00324534 predicted 818
5 SASI_Hs02_00324535 predicted 929
6 SASI_Hs02_00324536 predicted 508
7 SASI_Hs02_00324537 predicted 1026
8 SASI_Hs02_00324538 predicted 899
9 SASI_Hs02_00324539 predicted 1045
10 SASI_Hs02_00324540 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_117294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260790 predicted 2045
2 SASI_Hs01_00260791 predicted 1966
3 SASI_Hs01_00260792 predicted 1847
4 SASI_Hs01_00260793 predicted 1839
5 SASI_Hs01_00260794 predicted 1952
6 SASI_Hs01_00260795 predicted 1537
7 SASI_Hs01_00260796 predicted 2039
8 SASI_Hs01_00260797 predicted 1914
9 SASI_Hs01_00260798 predicted 2063
10 SASI_Hs01_00260799 predicted 1651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301259 predicted 1638
2 SASI_Hs01_00301260 predicted 1530
3 SASI_Hs01_00301261 predicted 1340
4 SASI_Hs01_00301262 predicted 1485
5 SASI_Hs01_00301263 predicted 1431
6 SASI_Hs01_00301264 predicted 1194
7 SASI_Hs01_00301265 predicted 1528
8 SASI_Hs01_00301266 predicted 1492
9 SASI_Hs01_00301267 predicted 1402
10 SASI_Hs01_00301268 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345328 predicted 805
2 SASI_Mm02_00345329 predicted 903
3 SASI_Mm02_00345330 predicted 1119
4 SASI_Mm02_00345331 predicted 1036
5 SASI_Mm02_00345332 predicted 872
6 SASI_Mm02_00345333 predicted 799
7 SASI_Mm02_00345334 predicted 808
8 SASI_Mm02_00345335 predicted 567
9 SASI_Mm02_00345336 predicted 1107
10 SASI_Mm02_00345337 predicted 1329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173439
VALIDATED
FBXO45 MISSION shRNA Bacterial Glycerol Stock
F-box protein 45
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173439.1-989s1c1
Sequence:CCGGGACATGGAGGATAAGACTTTACTCGAGTAAAGTCTTATCCTCCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173439.1-1076s1c1
Sequence:CCGGCCAGCTGTCTCTGCAGTATATCTCGAGATATACTGCAGAGACAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173439.1-1088s1c1
Sequence:CCGGGCAGTATATGGCAACACAGAACTCGAGTTCTGTGTTGCCATATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173439.1-643s1c1
Sequence:CCGGCTCCAGGAATGTCTATATCAACTCGAGTTGATATAGACATTCCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173439.1-1111s1c1
Sequence:CCGGGACTTTGGTTTATCTTGGAAACTCGAGTTTCCAAGATAAACCAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-873s21c1
Sequence:CCGGACGCACCAAAGTATCAGATAGCTCGAGCTATCTGATACTTTGGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173439.2-1130s21c1
Sequence:CCGGGAACCATGAAGTGATAGTATCCTCGAGGATACTATCACTTCATGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-750s21c1
Sequence:CCGGCCATGCAGTGCCAAGGTTATGCTCGAGCATAACCTTGGCACTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-917s21c1
Sequence:CCGGGACATGGAGGATAAGACTTTACTCGAGTAAAGTCTTATCCTCCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-806s21c1
Sequence:CCGGTGGAATCTGGTGGACAATAATCTCGAGATTATTGTCCACCAGATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-1016s21c1
Sequence:CCGGGCAGTATATGGCAACACAGAACTCGAGTTCTGTGTTGCCATATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173439
VALIDATED
FBXO45 MISSION shRNA shRNA Plasmid DNA
F-box protein 45
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173439.1-989s1c1
Sequence:CCGGGACATGGAGGATAAGACTTTACTCGAGTAAAGTCTTATCCTCCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173439.1-1076s1c1
Sequence:CCGGCCAGCTGTCTCTGCAGTATATCTCGAGATATACTGCAGAGACAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173439.1-1088s1c1
Sequence:CCGGGCAGTATATGGCAACACAGAACTCGAGTTCTGTGTTGCCATATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173439.1-643s1c1
Sequence:CCGGCTCCAGGAATGTCTATATCAACTCGAGTTGATATAGACATTCCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173439.1-1111s1c1
Sequence:CCGGGACTTTGGTTTATCTTGGAAACTCGAGTTTCCAAGATAAACCAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-873s21c1
Sequence:CCGGACGCACCAAAGTATCAGATAGCTCGAGCTATCTGATACTTTGGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173439.2-1130s21c1
Sequence:CCGGGAACCATGAAGTGATAGTATCCTCGAGGATACTATCACTTCATGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-750s21c1
Sequence:CCGGCCATGCAGTGCCAAGGTTATGCTCGAGCATAACCTTGGCACTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-917s21c1
Sequence:CCGGGACATGGAGGATAAGACTTTACTCGAGTAAAGTCTTATCCTCCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-806s21c1
Sequence:CCGGTGGAATCTGGTGGACAATAATCTCGAGATTATTGTCCACCAGATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-1016s21c1
Sequence:CCGGGCAGTATATGGCAACACAGAACTCGAGTTCTGTGTTGCCATATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173439
VALIDATED
FBXO45 MISSION shRNA Lentiviral Transduction Particles
F-box protein 45
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173439.1-989s1c1
Sequence:CCGGGACATGGAGGATAAGACTTTACTCGAGTAAAGTCTTATCCTCCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173439.1-1076s1c1
Sequence:CCGGCCAGCTGTCTCTGCAGTATATCTCGAGATATACTGCAGAGACAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173439.1-1088s1c1
Sequence:CCGGGCAGTATATGGCAACACAGAACTCGAGTTCTGTGTTGCCATATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173439.1-643s1c1
Sequence:CCGGCTCCAGGAATGTCTATATCAACTCGAGTTGATATAGACATTCCTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173439.1-1111s1c1
Sequence:CCGGGACTTTGGTTTATCTTGGAAACTCGAGTTTCCAAGATAAACCAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-873s21c1
Sequence:CCGGACGCACCAAAGTATCAGATAGCTCGAGCTATCTGATACTTTGGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173439.2-1130s21c1
Sequence:CCGGGAACCATGAAGTGATAGTATCCTCGAGGATACTATCACTTCATGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-750s21c1
Sequence:CCGGCCATGCAGTGCCAAGGTTATGCTCGAGCATAACCTTGGCACTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-917s21c1
Sequence:CCGGGACATGGAGGATAAGACTTTACTCGAGTAAAGTCTTATCCTCCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-806s21c1
Sequence:CCGGTGGAATCTGGTGGACAATAATCTCGAGATTATTGTCCACCAGATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173439.2-1016s21c1
Sequence:CCGGGCAGTATATGGCAACACAGAACTCGAGTTCTGTGTTGCCATATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105573
VALIDATED
FBXO45 MISSION shRNA Bacterial Glycerol Stock
F-box protein 45
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001105573.1-3193s21c1
Sequence:CCGGGGGCCTTCATTTACGTAAATTCTCGAGAATTTACGTAAATGAAGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001105573.1-667s21c1
Sequence:CCGGCCATGCAGTGCCAAGGTTATGCTCGAGCATAACCTTGGCACTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105573.1-556s21c1
Sequence:CCGGATGGTGCAAGGACCAAGATTGCTCGAGCAATCTTGGTCCTTGCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001105573.1-899s21c1
Sequence:CCGGACTTCCAAAGGTCTGCTTATACTCGAGTATAAGCAGACCTTTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105573.1-487s21c1
Sequence:CCGGGCTCCAGGAATGTCTACATTACTCGAGTAATGTAGACATTCCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105573
VALIDATED
FBXO45 MISSION shRNA shRNA Plasmid DNA
F-box protein 45
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001105573.1-3193s21c1
Sequence:CCGGGGGCCTTCATTTACGTAAATTCTCGAGAATTTACGTAAATGAAGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001105573.1-667s21c1
Sequence:CCGGCCATGCAGTGCCAAGGTTATGCTCGAGCATAACCTTGGCACTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105573.1-556s21c1
Sequence:CCGGATGGTGCAAGGACCAAGATTGCTCGAGCAATCTTGGTCCTTGCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001105573.1-899s21c1
Sequence:CCGGACTTCCAAAGGTCTGCTTATACTCGAGTATAAGCAGACCTTTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105573.1-487s21c1
Sequence:CCGGGCTCCAGGAATGTCTACATTACTCGAGTAATGTAGACATTCCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105573
VALIDATED
FBXO45 MISSION shRNA Lentiviral Transduction Particles
F-box protein 45
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001105573.1-3193s21c1
Sequence:CCGGGGGCCTTCATTTACGTAAATTCTCGAGAATTTACGTAAATGAAGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001105573.1-667s21c1
Sequence:CCGGCCATGCAGTGCCAAGGTTATGCTCGAGCATAACCTTGGCACTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105573.1-556s21c1
Sequence:CCGGATGGTGCAAGGACCAAGATTGCTCGAGCAATCTTGGTCCTTGCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001105573.1-899s21c1
Sequence:CCGGACTTCCAAAGGTCTGCTTATACTCGAGTATAAGCAGACCTTTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105573.1-487s21c1
Sequence:CCGGGCTCCAGGAATGTCTACATTACTCGAGTAATGTAGACATTCCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)