EMAIL THIS PAGE TO A FRIEND

FBXO46

F-box protein 46

114 Gene Product Result for
Synonyms: 20D7-FC4 FBXO34L Fbx46
UniProtKB ID: Q6PJ61
Gene ID:
Human(23403) Summary: Members of the F-box protein family, such as FBXO46, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(243867) F-box protein 46
Rat(292686) F-box protein 46
sheep(101114895) F-box protein 46
dog(612248) F-box protein 46
Horse(100065741) F-box protein 46
cow(100140560) F-box protein 46
domestic cat(101093225) F-box protein 46
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080469 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080469 Rosetta Predictions human pricing
XM_371179 Rosetta Predictions human pricing
XM_930410 Rosetta Predictions human pricing
XM_934741 Rosetta Predictions human pricing
XM_934742 Rosetta Predictions human pricing
XM_934743 Rosetta Predictions human pricing
NM_001025642 Rosetta Predictions rat pricing
NM_175530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315136 predicted 1491
2 SASI_Hs02_00315137 predicted 1026
3 SASI_Hs02_00315138 predicted 1695
4 SASI_Hs02_00315139 predicted 415
5 SASI_Hs02_00315140 predicted 1209
6 SASI_Hs02_00315141 predicted 374
7 SASI_Hs02_00315142 predicted 388
8 SASI_Hs02_00315143 predicted 493
9 SASI_Hs02_00315144 predicted 720
10 SASI_Hs02_00315145 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286501 predicted 1488
2 SASI_Hs01_00286502 predicted 1026
3 SASI_Hs01_00286503 predicted 1232
4 SASI_Hs01_00286504 predicted 1200
5 SASI_Hs01_00286505 predicted 1235
6 SASI_Hs01_00286506 predicted 1497
7 SASI_Hs01_00286507 predicted 1028
8 SASI_Hs01_00286508 predicted 1638
9 SASI_Hs01_00286509 predicted 1635
10 SASI_Hs01_00286510 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296965 predicted 2170
2 SASI_Hs01_00296966 predicted 1708
3 SASI_Hs01_00296967 predicted 1915
4 SASI_Hs01_00296968 predicted 1893
5 SASI_Hs01_00296969 predicted 1923
6 SASI_Hs01_00296970 predicted 2179
7 SASI_Hs01_00296971 predicted 1707
8 SASI_Hs01_00296972 predicted 2330
9 SASI_Hs01_00296973 predicted 2315
10 SASI_Hs01_00296974 predicted 1906
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268131 predicted 2049
2 SASI_Hs01_00268132 predicted 1580
3 SASI_Hs01_00268133 predicted 1790
4 SASI_Hs01_00268134 predicted 1767
5 SASI_Hs01_00268135 predicted 1791
6 SASI_Hs01_00268136 predicted 2052
7 SASI_Hs01_00268137 predicted 1585
8 SASI_Hs01_00268138 predicted 2207
9 SASI_Hs01_00268139 predicted 2192
10 SASI_Hs01_00268140 predicted 1780
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275060 predicted 1625
2 SASI_Hs01_00275061 predicted 1746
3 SASI_Hs01_00275062 predicted 1606
4 SASI_Hs01_00275063 predicted 1683
5 SASI_Hs01_00275064 predicted 1684
6 SASI_Hs01_00275065 predicted 1626
7 SASI_Hs01_00275066 predicted 1781
8 SASI_Hs01_00275067 predicted 1652
9 SASI_Hs01_00275068 predicted 1768
10 SASI_Hs01_00275069 predicted 1776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284100 predicted 1456
2 SASI_Hs01_00284101 predicted 991
3 SASI_Hs01_00284102 predicted 1199
4 SASI_Hs01_00284103 predicted 1169
5 SASI_Hs01_00284104 predicted 1207
6 SASI_Hs01_00284105 predicted 1462
7 SASI_Hs01_00284106 predicted 998
8 SASI_Hs01_00284107 predicted 1612
9 SASI_Hs01_00284108 predicted 1601
10 SASI_Hs01_00284109 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085790 predicted 1864
2 SASI_Rn01_00085791 predicted 927
3 SASI_Rn01_00085792 predicted 1630
4 SASI_Rn01_00085793 predicted 455
5 SASI_Rn01_00085794 predicted 442
6 SASI_Rn01_00085795 predicted 1699
7 SASI_Rn01_00085796 predicted 1183
8 SASI_Rn01_00085797 predicted 1627
9 SASI_Rn01_00085798 predicted 1688
10 SASI_Rn01_00085799 predicted 1885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346473 predicted 475
2 SASI_Mm01_00125549 predicted 1723
3 SASI_Mm01_00125550 predicted 1444
4 SASI_Mm01_00125551 predicted 450
5 SASI_Mm01_00125552 predicted 411
6 SASI_Mm01_00125553 predicted 1100
7 SASI_Mm01_00125554 predicted 1731
8 SASI_Mm01_00125555 predicted 1237
9 SASI_Mm01_00125556 predicted 869
10 SASI_Mm01_00125557 predicted 1235
11 SASI_Mm01_00125558 predicted 1238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175530
VALIDATED
FBXO46 MISSION shRNA Bacterial Glycerol Stock
F-box protein 46
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175530.2-1513s21c1
Sequence:CCGGTTCCTGGAGATTCGCTTTAAACTCGAGTTTAAAGCGAATCTCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175530.2-1580s21c1
Sequence:CCGGAGCACGTGCTCGTCAAGATATCTCGAGATATCTTGACGAGCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175530.2-962s21c1
Sequence:CCGGATTCACCAGATGGCAACTTACCTCGAGGTAAGTTGCCATCTGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175530.2-2764s21c1
Sequence:CCGGTTGGTTAACTGGGACCTTAATCTCGAGATTAAGGTCCCAGTTAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175530.2-491s21c1
Sequence:CCGGCCAGCTCTATGAAGGTCAAAGCTCGAGCTTTGACCTTCATAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175530.2-2673s1c1
Sequence:CCGGGCCAGGATTCTTCTTCCACTTCTCGAGAAGTGGAAGAAGAATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175530.2-1587s1c1
Sequence:CCGGGCTCGTCAAGATATTCAGCTTCTCGAGAAGCTGAATATCTTGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175530.2-2674s1c1
Sequence:CCGGCCAGGATTCTTCTTCCACTTTCTCGAGAAAGTGGAAGAAGAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175530
VALIDATED
FBXO46 MISSION shRNA shRNA Plasmid DNA
F-box protein 46
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175530.2-1513s21c1
Sequence:CCGGTTCCTGGAGATTCGCTTTAAACTCGAGTTTAAAGCGAATCTCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175530.2-1580s21c1
Sequence:CCGGAGCACGTGCTCGTCAAGATATCTCGAGATATCTTGACGAGCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175530.2-962s21c1
Sequence:CCGGATTCACCAGATGGCAACTTACCTCGAGGTAAGTTGCCATCTGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175530.2-2764s21c1
Sequence:CCGGTTGGTTAACTGGGACCTTAATCTCGAGATTAAGGTCCCAGTTAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175530.2-491s21c1
Sequence:CCGGCCAGCTCTATGAAGGTCAAAGCTCGAGCTTTGACCTTCATAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175530.2-2673s1c1
Sequence:CCGGGCCAGGATTCTTCTTCCACTTCTCGAGAAGTGGAAGAAGAATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175530.2-1587s1c1
Sequence:CCGGGCTCGTCAAGATATTCAGCTTCTCGAGAAGCTGAATATCTTGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175530.2-2674s1c1
Sequence:CCGGCCAGGATTCTTCTTCCACTTTCTCGAGAAAGTGGAAGAAGAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175530
VALIDATED
FBXO46 MISSION shRNA Lentiviral Transduction Particles
F-box protein 46
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175530.2-1513s21c1
Sequence:CCGGTTCCTGGAGATTCGCTTTAAACTCGAGTTTAAAGCGAATCTCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175530.2-1580s21c1
Sequence:CCGGAGCACGTGCTCGTCAAGATATCTCGAGATATCTTGACGAGCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175530.2-962s21c1
Sequence:CCGGATTCACCAGATGGCAACTTACCTCGAGGTAAGTTGCCATCTGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175530.2-2764s21c1
Sequence:CCGGTTGGTTAACTGGGACCTTAATCTCGAGATTAAGGTCCCAGTTAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175530.2-491s21c1
Sequence:CCGGCCAGCTCTATGAAGGTCAAAGCTCGAGCTTTGACCTTCATAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175530.2-2673s1c1
Sequence:CCGGGCCAGGATTCTTCTTCCACTTCTCGAGAAGTGGAAGAAGAATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175530.2-1587s1c1
Sequence:CCGGGCTCGTCAAGATATTCAGCTTCTCGAGAAGCTGAATATCTTGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175530.2-2674s1c1
Sequence:CCGGCCAGGATTCTTCTTCCACTTTCTCGAGAAAGTGGAAGAAGAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080469
FBXO46 MISSION shRNA Bacterial Glycerol Stock
F-box protein 46
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1019s21c1
Sequence:CCGGGAGCCAAGGACAAGATCACATCTCGAGATGTGATCTTGTCCTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1559s21c1
Sequence:CCGGACGTGCTGGTCAAGATCTTCACTCGAGTGAAGATCTTGACCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080469.1-2483s21c1
Sequence:CCGGCTAGATGGTTTGCCTATTAAACTCGAGTTTAATAGGCAAACCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1696s21c1
Sequence:CCGGTACCGCGATGATCCGTGCAAACTCGAGTTTGCACGGATCATCGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1479s21c1
Sequence:CCGGGTCGCACGACTTCCTAGAGATCTCGAGATCTCTAGGAAGTCGTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080469
FBXO46 MISSION shRNA shRNA Plasmid DNA
F-box protein 46
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1019s21c1
Sequence:CCGGGAGCCAAGGACAAGATCACATCTCGAGATGTGATCTTGTCCTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1559s21c1
Sequence:CCGGACGTGCTGGTCAAGATCTTCACTCGAGTGAAGATCTTGACCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080469.1-2483s21c1
Sequence:CCGGCTAGATGGTTTGCCTATTAAACTCGAGTTTAATAGGCAAACCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1696s21c1
Sequence:CCGGTACCGCGATGATCCGTGCAAACTCGAGTTTGCACGGATCATCGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1479s21c1
Sequence:CCGGGTCGCACGACTTCCTAGAGATCTCGAGATCTCTAGGAAGTCGTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080469
FBXO46 MISSION shRNA Lentiviral Transduction Particles
F-box protein 46
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1019s21c1
Sequence:CCGGGAGCCAAGGACAAGATCACATCTCGAGATGTGATCTTGTCCTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1559s21c1
Sequence:CCGGACGTGCTGGTCAAGATCTTCACTCGAGTGAAGATCTTGACCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080469.1-2483s21c1
Sequence:CCGGCTAGATGGTTTGCCTATTAAACTCGAGTTTAATAGGCAAACCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1696s21c1
Sequence:CCGGTACCGCGATGATCCGTGCAAACTCGAGTTTGCACGGATCATCGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080469.1-1479s21c1
Sequence:CCGGGTCGCACGACTTCCTAGAGATCTCGAGATCTCTAGGAAGTCGTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks