EMAIL THIS PAGE TO A FRIEND

FBXO47

F-box protein 47

144 Gene Product Result for
UniProtKB ID: Q5MNV8, B2RTZ4
Gene ID:
Mouse(72973) F-box protein 47
Rat(360615) F-box protein 47
chicken(771854) F-box protein 47
cow(613655) F-box protein 47
Horse(100068413) F-box protein 47
domestic cat(101088532) F-box protein 47
dog(100683516) F-box protein 47
naked mole-rat(101716901) F-box protein 47
sheep(101122449) F-box protein 47
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008777 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160851 MISSION® esiRNA esiRNA human FBXO47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008777 Rosetta Predictions human pricing
XM_001081385 Rosetta Predictions rat pricing
XM_346901 Rosetta Predictions rat pricing
NM_001081435 Rosetta Predictions mouse pricing
XM_994781 Rosetta Predictions mouse pricing
XM_994800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145723 predicted 524
2 SASI_Hs02_00305564 predicted 1187
3 SASI_Hs01_00145725 predicted 1058
4 SASI_Hs01_00145726 predicted 233
5 SASI_Hs01_00145728 predicted 663
6 SASI_Hs01_00145730 predicted 947
7 SASI_Hs01_00145731 predicted 1340
8 SASI_Hs02_00305565 predicted 1039
9 SASI_Hs01_00145732 predicted 765
10 SASI_Hs02_00305566 predicted 1102
11 SASI_Hs01_00145724 predicted 1549
12 SASI_Hs01_00145727 predicted 1420
13 SASI_Hs01_00145729 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371679 predicted 567
2 SASI_Rn02_00371680 predicted 475
3 SASI_Rn02_00371681 predicted 849
4 SASI_Rn02_00371682 predicted 785
5 SASI_Rn02_00371683 predicted 320
6 SASI_Rn02_00371684 predicted 657
7 SASI_Rn02_00371685 predicted 855
8 SASI_Rn02_00371686 predicted 1436
9 SASI_Rn02_00371687 predicted 746
10 SASI_Rn02_00371688 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180164 predicted 795
2 SASI_Rn01_00180165 predicted 689
3 SASI_Rn01_00180166 predicted 606
4 SASI_Rn01_00180167 predicted 299
5 SASI_Rn01_00180168 predicted 798
6 SASI_Rn01_00180169 predicted 269
7 SASI_Rn01_00180170 predicted 449
8 SASI_Rn01_00180171 predicted 810
9 SASI_Rn01_00180172 predicted 353
10 SASI_Rn01_00180173 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298351 predicted 1080
2 SASI_Mm02_00298352 predicted 820
3 SASI_Mm02_00298353 predicted 728
4 SASI_Mm02_00298354 predicted 681
5 SASI_Mm02_00298355 predicted 1103
6 SASI_Mm02_00298356 predicted 651
7 SASI_Mm02_00298357 predicted 1160
8 SASI_Mm02_00298358 predicted 1231
9 SASI_Mm02_00298359 predicted 1261
10 SASI_Mm02_00298360 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274443 predicted 479
2 SASI_Mm01_00274444 predicted 485
3 SASI_Mm01_00274445 predicted 580
4 SASI_Mm01_00274446 predicted 407
5 SASI_Mm01_00274447 predicted 437
6 SASI_Mm01_00274448 predicted 599
7 SASI_Mm01_00274449 predicted 345
8 SASI_Mm01_00274450 predicted 364
9 SASI_Mm01_00274451 predicted 556
10 SASI_Mm01_00274452 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271668 predicted 479
2 SASI_Mm01_00271669 predicted 474
3 SASI_Mm01_00271670 predicted 561
4 SASI_Mm01_00271671 predicted 387
5 SASI_Mm01_00271672 predicted 411
6 SASI_Mm01_00271673 predicted 556
7 SASI_Mm01_00271674 predicted 426
8 SASI_Mm01_00271675 predicted 439
9 SASI_Mm01_00271676 predicted 426
10 SASI_Mm01_00271677 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008777
FBXO47 MISSION shRNA Bacterial Glycerol Stock
F-box protein 47
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-883s1c1
Sequence:CCGGCACATCGAAGTGATTCTGCTTCTCGAGAAGCAGAATCACTTCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-784s1c1
Sequence:CCGGGCAAGATACAAATGGCTGTCTCTCGAGAGACAGCCATTTGTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-259s1c1
Sequence:CCGGGTAATCGTCAAACCAGCTGTTCTCGAGAACAGCTGGTTTGACGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157275    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008777.1-1743s1c1
Sequence:CCGGGCCTCAAGAATGTGCTGAGATCTCGAGATCTCAGCACATTCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-660s1c1
Sequence:CCGGGCTCCTATGCAGTGTTTAGGACTCGAGTCCTAAACACTGCATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008777
FBXO47 MISSION shRNA shRNA Plasmid DNA
F-box protein 47
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-883s1c1
Sequence:CCGGCACATCGAAGTGATTCTGCTTCTCGAGAAGCAGAATCACTTCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-784s1c1
Sequence:CCGGGCAAGATACAAATGGCTGTCTCTCGAGAGACAGCCATTTGTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-259s1c1
Sequence:CCGGGTAATCGTCAAACCAGCTGTTCTCGAGAACAGCTGGTTTGACGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157275    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008777.1-1743s1c1
Sequence:CCGGGCCTCAAGAATGTGCTGAGATCTCGAGATCTCAGCACATTCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-660s1c1
Sequence:CCGGGCTCCTATGCAGTGTTTAGGACTCGAGTCCTAAACACTGCATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008777
FBXO47 MISSION shRNA Lentiviral Transduction Particles
F-box protein 47
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-883s1c1
Sequence:CCGGCACATCGAAGTGATTCTGCTTCTCGAGAAGCAGAATCACTTCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-784s1c1
Sequence:CCGGGCAAGATACAAATGGCTGTCTCTCGAGAGACAGCCATTTGTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-259s1c1
Sequence:CCGGGTAATCGTCAAACCAGCTGTTCTCGAGAACAGCTGGTTTGACGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157275    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008777.1-1743s1c1
Sequence:CCGGGCCTCAAGAATGTGCTGAGATCTCGAGATCTCAGCACATTCTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008777.1-660s1c1
Sequence:CCGGGCTCCTATGCAGTGTTTAGGACTCGAGTCCTAAACACTGCATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081435
FBXO47 MISSION shRNA Bacterial Glycerol Stock
F-box protein 47
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-600s21c1
Sequence:CCGGGAGCTCTAGGTCTACTATTTACTCGAGTAAATAGTAGACCTAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-889s21c1
Sequence:CCGGAGAGTTAAGGGTTAGACTATTCTCGAGAATAGTCTAACCCTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-813s21c1
Sequence:CCGGTCTTATGTGAGCTGACTAATCCTCGAGGATTAGTCAGCTCACATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-999s21c1
Sequence:CCGGATCAGGCAAGATTGCTATATACTCGAGTATATAGCAATCTTGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-475s21c1
Sequence:CCGGAGTCAGCCAGCACATAATTAACTCGAGTTAATTATGTGCTGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081435
FBXO47 MISSION shRNA shRNA Plasmid DNA
F-box protein 47
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-600s21c1
Sequence:CCGGGAGCTCTAGGTCTACTATTTACTCGAGTAAATAGTAGACCTAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-889s21c1
Sequence:CCGGAGAGTTAAGGGTTAGACTATTCTCGAGAATAGTCTAACCCTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-813s21c1
Sequence:CCGGTCTTATGTGAGCTGACTAATCCTCGAGGATTAGTCAGCTCACATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-999s21c1
Sequence:CCGGATCAGGCAAGATTGCTATATACTCGAGTATATAGCAATCTTGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-475s21c1
Sequence:CCGGAGTCAGCCAGCACATAATTAACTCGAGTTAATTATGTGCTGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081435
FBXO47 MISSION shRNA Lentiviral Transduction Particles
F-box protein 47
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-600s21c1
Sequence:CCGGGAGCTCTAGGTCTACTATTTACTCGAGTAAATAGTAGACCTAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-889s21c1
Sequence:CCGGAGAGTTAAGGGTTAGACTATTCTCGAGAATAGTCTAACCCTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-813s21c1
Sequence:CCGGTCTTATGTGAGCTGACTAATCCTCGAGGATTAGTCAGCTCACATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-999s21c1
Sequence:CCGGATCAGGCAAGATTGCTATATACTCGAGTATATAGCAATCTTGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081435.1-475s21c1
Sequence:CCGGAGTCAGCCAGCACATAATTAACTCGAGTTAATTATGTGCTGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks