EMAIL THIS PAGE TO A FRIEND

FBXO48

F-box protein 48

UniProtKB ID: Q5FWF7
Gene ID:
Mouse(319701) F-box protein 48
Rat(364205) F-box protein 48
sheep(101109950) F-box protein 48
naked mole-rat(101705162) F-box protein 48
chicken(421265) F-box protein 48
domestic cat(101091358) F-box protein 48
dog(100684024) F-box protein 48
cow(786890) F-box protein 48
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176982 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176982 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176982 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001024680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024680 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024680 Rosetta Predictions human pricing
NM_001108863 Rosetta Predictions rat pricing
NM_176982 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202914 predicted 1239
2 SASI_Hs01_00202915 predicted 1229
3 SASI_Hs01_00202916 predicted 594
4 SASI_Hs02_00307239 predicted 1135
5 SASI_Hs01_00202920 predicted 1259
6 SASI_Hs01_00202921 predicted 1181
7 SASI_Hs01_00202922 predicted 1120
8 SASI_Hs01_00202923 predicted 1353
9 SASI_Hs02_00307240 predicted 599
10 SASI_Hs02_00307241 predicted 1282
11 SASI_Hs01_00202917 predicted 1224
12 SASI_Hs01_00202918 predicted 1116
13 SASI_Hs01_00202919 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242825 predicted 365
2 SASI_Rn02_00242826 predicted 380
3 SASI_Rn02_00242827 predicted 468
4 SASI_Rn02_00242828 predicted 222
5 SASI_Rn02_00242829 predicted 334
6 SASI_Rn02_00242830 predicted 313
7 SASI_Rn02_00242831 predicted 454
8 SASI_Rn02_00242832 predicted 229
9 SASI_Rn02_00242833 predicted 435
10 SASI_Rn02_00242834 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346900 predicted 1274
2 SASI_Mm02_00346901 predicted 1332
3 SASI_Mm02_00346902 predicted 1577
4 SASI_Mm02_00346903 predicted 1295
5 SASI_Mm02_00346904 predicted 1478
6 SASI_Mm02_00346905 predicted 1336
7 SASI_Mm02_00346906 predicted 1713
8 SASI_Mm02_00346907 predicted 1541
9 SASI_Mm02_00346908 predicted 1459
10 SASI_Mm02_00346909 predicted 1711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176982
FBXO48 MISSION shRNA Bacterial Glycerol Stock
F-box protein 48
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1460s21c1
Sequence:CCGGGAGAAATAGACGATGATATAACTCGAGTTATATCATCGTCTATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1486s21c1
Sequence:CCGGGGTTATACCTGGAGGGTAATACTCGAGTATTACCCTCCAGGTATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1340s21c1
Sequence:CCGGAGCTAGACATTCAGAGTTTATCTCGAGATAAACTCTGAATGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1308s21c1
Sequence:CCGGGCCCTTGGAAGTCACTTATAACTCGAGTTATAAGTGACTTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176982.2-1705s21c1
Sequence:CCGGCTCGGACTCCAAGATACTTTGCTCGAGCAAAGTATCTTGGAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176982.2-1338s1c1
Sequence:CCGGCCAGCTAGACATTCAGAGTTTCTCGAGAAACTCTGAATGTCTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176982.2-1709s1c1
Sequence:CCGGGACTCCAAGATACTTTGAAATCTCGAGATTTCAAAGTATCTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176982.2-1439s1c1
Sequence:CCGGCCATAAGAGCTGTGTGCCAAACTCGAGTTTGGCACACAGCTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176982
FBXO48 MISSION shRNA shRNA Plasmid DNA
F-box protein 48
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1460s21c1
Sequence:CCGGGAGAAATAGACGATGATATAACTCGAGTTATATCATCGTCTATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1486s21c1
Sequence:CCGGGGTTATACCTGGAGGGTAATACTCGAGTATTACCCTCCAGGTATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1340s21c1
Sequence:CCGGAGCTAGACATTCAGAGTTTATCTCGAGATAAACTCTGAATGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1308s21c1
Sequence:CCGGGCCCTTGGAAGTCACTTATAACTCGAGTTATAAGTGACTTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176982.2-1705s21c1
Sequence:CCGGCTCGGACTCCAAGATACTTTGCTCGAGCAAAGTATCTTGGAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176982.2-1338s1c1
Sequence:CCGGCCAGCTAGACATTCAGAGTTTCTCGAGAAACTCTGAATGTCTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176982.2-1709s1c1
Sequence:CCGGGACTCCAAGATACTTTGAAATCTCGAGATTTCAAAGTATCTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176982.2-1439s1c1
Sequence:CCGGCCATAAGAGCTGTGTGCCAAACTCGAGTTTGGCACACAGCTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176982
FBXO48 MISSION shRNA Lentiviral Transduction Particles
F-box protein 48
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1460s21c1
Sequence:CCGGGAGAAATAGACGATGATATAACTCGAGTTATATCATCGTCTATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1486s21c1
Sequence:CCGGGGTTATACCTGGAGGGTAATACTCGAGTATTACCCTCCAGGTATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1340s21c1
Sequence:CCGGAGCTAGACATTCAGAGTTTATCTCGAGATAAACTCTGAATGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176982.2-1308s21c1
Sequence:CCGGGCCCTTGGAAGTCACTTATAACTCGAGTTATAAGTGACTTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176982.2-1705s21c1
Sequence:CCGGCTCGGACTCCAAGATACTTTGCTCGAGCAAAGTATCTTGGAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176982.2-1338s1c1
Sequence:CCGGCCAGCTAGACATTCAGAGTTTCTCGAGAAACTCTGAATGTCTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176982.2-1709s1c1
Sequence:CCGGGACTCCAAGATACTTTGAAATCTCGAGATTTCAAAGTATCTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176982.2-1439s1c1
Sequence:CCGGCCATAAGAGCTGTGTGCCAAACTCGAGTTTGGCACACAGCTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024680
FBXO48 MISSION shRNA Bacterial Glycerol Stock
F-box protein 48
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024680.1-779s1c1
Sequence:CCGGGCAACATTTGTTCTCCCATTACTCGAGTAATGGGAGAACAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024680.1-519s1c1
Sequence:CCGGGCTGCCTGCAGAAATCACTTTCTCGAGAAAGTGATTTCTGCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024680.1-462s1c1
Sequence:CCGGGAACTCTGTGGATGCTGAGAACTCGAGTTCTCAGCATCCACAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024680.1-2298s1c1
Sequence:CCGGGCCAGATATTTGAAGACTGATCTCGAGATCAGTCTTCAAATATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024680
FBXO48 MISSION shRNA shRNA Plasmid DNA
F-box protein 48
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024680.1-779s1c1
Sequence:CCGGGCAACATTTGTTCTCCCATTACTCGAGTAATGGGAGAACAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024680.1-519s1c1
Sequence:CCGGGCTGCCTGCAGAAATCACTTTCTCGAGAAAGTGATTTCTGCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024680.1-462s1c1
Sequence:CCGGGAACTCTGTGGATGCTGAGAACTCGAGTTCTCAGCATCCACAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024680.1-2298s1c1
Sequence:CCGGGCCAGATATTTGAAGACTGATCTCGAGATCAGTCTTCAAATATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024680
FBXO48 MISSION shRNA Lentiviral Transduction Particles
F-box protein 48
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024680.1-779s1c1
Sequence:CCGGGCAACATTTGTTCTCCCATTACTCGAGTAATGGGAGAACAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024680.1-519s1c1
Sequence:CCGGGCTGCCTGCAGAAATCACTTTCTCGAGAAAGTGATTTCTGCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024680.1-462s1c1
Sequence:CCGGGAACTCTGTGGATGCTGAGAACTCGAGTTCTCAGCATCCACAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024680.1-2298s1c1
Sequence:CCGGGCCAGATATTTGAAGACTGATCTCGAGATCAGTCTTCAAATATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks