EMAIL THIS PAGE TO A FRIEND

FBXO4

F-box protein 4

107 Gene Product Result for
Synonyms: FBX4
UniProtKB ID: Q9UKT5, Q68CU8, Q86VT8, Q9UK98
Gene ID:
Human(26272) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Mouse(106052) F-box protein 4
Rat(310363) F-box protein 4
chicken(431586) F-box protein 4
dog(489220) F-box protein 4
cow(534852) F-box protein 4
domestic cat(101093916) F-box protein 4
naked mole-rat(101717865) F-box protein 4
sheep(101116349) F-box protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012176 Rosetta Predictions human pricing
NM_033484 Rosetta Predictions human pricing
NM_001107672 Rosetta Predictions rat pricing
NM_134099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063506 predicted 433
2 SASI_Hs01_00063507 predicted 240
3 SASI_Hs01_00063508 predicted 338
4 SASI_Hs02_00343785 predicted 720
5 SASI_Hs01_00063510 predicted 369
6 SASI_Hs01_00063511 predicted 565
7 SASI_Hs01_00063512 predicted 569
8 SASI_Hs01_00063513 predicted 461
9 SASI_Hs01_00063514 predicted 277
10 SASI_Hs02_00343786 predicted 673
11 SASI_Hs01_00063509 predicted 731
12 SASI_Hs01_00063515 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218079 predicted 429
2 SASI_Hs01_00218080 predicted 239
3 SASI_Hs01_00218081 predicted 333
4 SASI_Hs02_00361353 predicted 724
5 SASI_Hs01_00218083 predicted 370
6 SASI_Hs01_00218084 predicted 562
7 SASI_Hs01_00218085 predicted 571
8 SASI_Hs01_00218086 predicted 461
9 SASI_Hs01_00218087 predicted 278
10 SASI_Hs02_00361354 predicted 666
11 SASI_Hs01_00218082 predicted 731
12 SASI_Hs01_00218088 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231135 predicted 1089
2 SASI_Rn02_00231136 predicted 1280
3 SASI_Rn02_00231137 predicted 1297
4 SASI_Rn02_00231138 predicted 1137
5 SASI_Rn02_00231139 predicted 1072
6 SASI_Rn02_00231140 predicted 662
7 SASI_Rn02_00231141 predicted 1579
8 SASI_Rn02_00231142 predicted 951
9 SASI_Rn02_00231143 predicted 932
10 SASI_Rn02_00231144 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036607 predicted 424
2 SASI_Mm01_00036608 predicted 798
3 SASI_Mm01_00036609 predicted 840
4 SASI_Mm02_00339328 predicted 807
5 SASI_Mm02_00339329 predicted 390
6 SASI_Mm01_00036612 predicted 521
7 SASI_Mm02_00339330 predicted 761
8 SASI_Mm01_00036613 predicted 777
9 SASI_Mm01_00036614 predicted 340
10 SASI_Mm01_00036615 predicted 327
11 SASI_Mm01_00036610 predicted 1143
12 SASI_Mm01_00036611 predicted 1267
13 SASI_Mm01_00036616 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012176
FBXO4 MISSION shRNA Bacterial Glycerol Stock
F-box protein 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-606s1c1
Sequence:CCGGCCAGGTTTGGAAGAATTGAATCTCGAGATTCAATTCTTCCAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-244s1c1
Sequence:CCGGCGATTGATGTACAGCTATATACTCGAGTATATAGCTGTACATCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-435s1c1
Sequence:CCGGCCTATATCTGAGGTCACTGATCTCGAGATCAGTGACCTCAGATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-1018s1c1
Sequence:CCGGCGGGAAGACCATTGTTGGTTTCTCGAGAAACCAACAATGGTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-1097s1c1
Sequence:CCGGGCTGCATCTGAATCTTCTAAACTCGAGTTTAGAAGATTCAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012176.2-703s21c1
Sequence:CCGGGTATTGGATCAGGAGTCAATTCTCGAGAATTGACTCCTGATCCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012176.2-726s21c1
Sequence:CCGGCAGTTGAACAACCAACATAAACTCGAGTTTATGTTGGTTGTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012176
FBXO4 MISSION shRNA shRNA Plasmid DNA
F-box protein 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-606s1c1
Sequence:CCGGCCAGGTTTGGAAGAATTGAATCTCGAGATTCAATTCTTCCAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-244s1c1
Sequence:CCGGCGATTGATGTACAGCTATATACTCGAGTATATAGCTGTACATCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-435s1c1
Sequence:CCGGCCTATATCTGAGGTCACTGATCTCGAGATCAGTGACCTCAGATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-1018s1c1
Sequence:CCGGCGGGAAGACCATTGTTGGTTTCTCGAGAAACCAACAATGGTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-1097s1c1
Sequence:CCGGGCTGCATCTGAATCTTCTAAACTCGAGTTTAGAAGATTCAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012176.2-703s21c1
Sequence:CCGGGTATTGGATCAGGAGTCAATTCTCGAGAATTGACTCCTGATCCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012176.2-726s21c1
Sequence:CCGGCAGTTGAACAACCAACATAAACTCGAGTTTATGTTGGTTGTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012176
FBXO4 MISSION shRNA Lentiviral Transduction Particles
F-box protein 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-606s1c1
Sequence:CCGGCCAGGTTTGGAAGAATTGAATCTCGAGATTCAATTCTTCCAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-244s1c1
Sequence:CCGGCGATTGATGTACAGCTATATACTCGAGTATATAGCTGTACATCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-435s1c1
Sequence:CCGGCCTATATCTGAGGTCACTGATCTCGAGATCAGTGACCTCAGATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-1018s1c1
Sequence:CCGGCGGGAAGACCATTGTTGGTTTCTCGAGAAACCAACAATGGTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012176.1-1097s1c1
Sequence:CCGGGCTGCATCTGAATCTTCTAAACTCGAGTTTAGAAGATTCAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012176.2-703s21c1
Sequence:CCGGGTATTGGATCAGGAGTCAATTCTCGAGAATTGACTCCTGATCCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012176.2-726s21c1
Sequence:CCGGCAGTTGAACAACCAACATAAACTCGAGTTTATGTTGGTTGTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134099
VALIDATED
FBXO4 MISSION shRNA Bacterial Glycerol Stock
F-box protein 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-1333s1c1
Sequence:CCGGGCAGGACATGGTGTATGTGTTCTCGAGAACACATACACCATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-330s1c1
Sequence:CCGGCCGGTTGATGTGCAGTTGTATCTCGAGATACAACTGCACATCAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-539s1c1
Sequence:CCGGCGACAGCACTTGTCTTGATTACTCGAGTAATCAAGACAAGTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-1038s1c1
Sequence:CCGGCGACGTCATGAATGGCAAGATCTCGAGATCTTGCCATTCATGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-386s1c1
Sequence:CCGGGCTGGGAAGTACAGATCATTACTCGAGTAATGATCTGTACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134099.1-386s21c1
Sequence:CCGGGCTGGGAAGTACAGATCATTACTCGAGTAATGATCTGTACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134099.1-1333s21c1
Sequence:CCGGGCAGGACATGGTGTATGTGTTCTCGAGAACACATACACCATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134099.1-1038s21c1
Sequence:CCGGCGACGTCATGAATGGCAAGATCTCGAGATCTTGCCATTCATGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134099.1-539s21c1
Sequence:CCGGCGACAGCACTTGTCTTGATTACTCGAGTAATCAAGACAAGTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134099
VALIDATED
FBXO4 MISSION shRNA shRNA Plasmid DNA
F-box protein 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-1333s1c1
Sequence:CCGGGCAGGACATGGTGTATGTGTTCTCGAGAACACATACACCATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-330s1c1
Sequence:CCGGCCGGTTGATGTGCAGTTGTATCTCGAGATACAACTGCACATCAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-539s1c1
Sequence:CCGGCGACAGCACTTGTCTTGATTACTCGAGTAATCAAGACAAGTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-1038s1c1
Sequence:CCGGCGACGTCATGAATGGCAAGATCTCGAGATCTTGCCATTCATGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-386s1c1
Sequence:CCGGGCTGGGAAGTACAGATCATTACTCGAGTAATGATCTGTACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134099.1-386s21c1
Sequence:CCGGGCTGGGAAGTACAGATCATTACTCGAGTAATGATCTGTACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134099.1-1333s21c1
Sequence:CCGGGCAGGACATGGTGTATGTGTTCTCGAGAACACATACACCATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134099.1-1038s21c1
Sequence:CCGGCGACGTCATGAATGGCAAGATCTCGAGATCTTGCCATTCATGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134099.1-539s21c1
Sequence:CCGGCGACAGCACTTGTCTTGATTACTCGAGTAATCAAGACAAGTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134099
VALIDATED
FBXO4 MISSION shRNA Lentiviral Transduction Particles
F-box protein 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-1333s1c1
Sequence:CCGGGCAGGACATGGTGTATGTGTTCTCGAGAACACATACACCATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-330s1c1
Sequence:CCGGCCGGTTGATGTGCAGTTGTATCTCGAGATACAACTGCACATCAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-539s1c1
Sequence:CCGGCGACAGCACTTGTCTTGATTACTCGAGTAATCAAGACAAGTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-1038s1c1
Sequence:CCGGCGACGTCATGAATGGCAAGATCTCGAGATCTTGCCATTCATGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134099.1-386s1c1
Sequence:CCGGGCTGGGAAGTACAGATCATTACTCGAGTAATGATCTGTACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134099.1-386s21c1
Sequence:CCGGGCTGGGAAGTACAGATCATTACTCGAGTAATGATCTGTACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134099.1-1333s21c1
Sequence:CCGGGCAGGACATGGTGTATGTGTTCTCGAGAACACATACACCATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134099.1-1038s21c1
Sequence:CCGGCGACGTCATGAATGGCAAGATCTCGAGATCTTGCCATTCATGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134099.1-539s21c1
Sequence:CCGGCGACAGCACTTGTCTTGATTACTCGAGTAATCAAGACAAGTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks