EMAIL THIS PAGE TO A FRIEND

FBXO5

F-box protein 5

71 Gene Product Result for
Synonyms: EMI1 FBX5 Fbxo31
UniProtKB ID: Q9UKT4, B3KNX5, Q5TF47, Q8WV29, Q9UGC8
Gene ID:
Human(26271) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. This protein is similar to xenopus early mitotic inhibitor-1 (Emi1), which is a mitotic regulator that interacts with Cdc20 and inhibits the anaphase promoting complex. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Dec 2008]
Mouse(67141) F-box protein 5
Rat(292263) F-box protein 5
Zebrafish(445392) F-box protein 5
cow(515080) F-box protein 5
domestic cat(101089013) F-box protein 5
dog(612020) F-box protein 5
chicken(421642) F-box protein 5
naked mole-rat(101713387) F-box protein 5
sheep(101103731) F-box protein 5
Domestic Rabbit(100353279) F-box protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025995 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025995 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025995 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012177 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012177 Rosetta Predictions human pricing
NM_001106206 Rosetta Predictions rat pricing
NM_025995 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343787 predicted 1142
2 SASI_Hs02_00343788 predicted 449
3 SASI_Hs01_00029681 predicted 340
4 SASI_Hs01_00029682 predicted 1094
5 SASI_Hs01_00029684 predicted 1153
6 SASI_Hs02_00343789 predicted 948
7 SASI_Hs02_00343790 predicted 1112
8 SASI_Hs01_00029687 predicted 597
9 SASI_Hs02_00343791 predicted 952
10 SASI_Hs02_00343792 predicted 1208
11 SASI_Hs01_00029680 predicted 384
12 SASI_Hs01_00029683 predicted 887
13 SASI_Hs01_00029685 predicted 1123
14 SASI_Hs01_00029686 predicted 818
15 SASI_Hs01_00029688 predicted 845
16 SASI_Hs01_00029689 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216678 predicted 1153
2 SASI_Rn02_00216679 predicted 393
3 SASI_Rn02_00216680 predicted 858
4 SASI_Rn02_00216681 predicted 906
5 SASI_Rn02_00216682 predicted 707
6 SASI_Rn02_00216683 predicted 958
7 SASI_Rn02_00216684 predicted 344
8 SASI_Rn02_00216685 predicted 891
9 SASI_Rn02_00216686 predicted 1198
10 SASI_Rn02_00216687 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042465 predicted 1171
2 SASI_Mm01_00042466 predicted 396
3 SASI_Mm02_00329448 predicted 713
4 SASI_Mm01_00042470 predicted 852
5 SASI_Mm01_00042471 predicted 853
6 SASI_Mm01_00042472 predicted 1150
7 SASI_Mm01_00042467 predicted 711
8 SASI_Mm01_00042468 predicted 732
9 SASI_Mm01_00042469 predicted 325
10 SASI_Mm01_00042473 predicted 327
11 SASI_Mm01_00042474 predicted 1230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025995
FBXO5 MISSION shRNA Bacterial Glycerol Stock
F-box protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-1185s1c1
Sequence:CCGGTCGCTGTAATTTCCCTGCAAACTCGAGTTTGCAGGGAAATTACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-1172s1c1
Sequence:CCGGTCAAAGCCTGTGTTCGCTGTACTCGAGTACAGCGAACACAGGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-854s1c1
Sequence:CCGGGCATGGACTTAGTAAATCTGTCTCGAGACAGATTTACTAAGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-857s1c1
Sequence:CCGGTGGACTTAGTAAATCTGTCTACTCGAGTAGACAGATTTACTAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-400s1c1
Sequence:CCGGGTGGGACATGATAACAAGGAACTCGAGTTCCTTGTTATCATGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025995
FBXO5 MISSION shRNA shRNA Plasmid DNA
F-box protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-1185s1c1
Sequence:CCGGTCGCTGTAATTTCCCTGCAAACTCGAGTTTGCAGGGAAATTACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-1172s1c1
Sequence:CCGGTCAAAGCCTGTGTTCGCTGTACTCGAGTACAGCGAACACAGGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-854s1c1
Sequence:CCGGGCATGGACTTAGTAAATCTGTCTCGAGACAGATTTACTAAGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-857s1c1
Sequence:CCGGTGGACTTAGTAAATCTGTCTACTCGAGTAGACAGATTTACTAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-400s1c1
Sequence:CCGGGTGGGACATGATAACAAGGAACTCGAGTTCCTTGTTATCATGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025995
FBXO5 MISSION shRNA Lentiviral Transduction Particles
F-box protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-1185s1c1
Sequence:CCGGTCGCTGTAATTTCCCTGCAAACTCGAGTTTGCAGGGAAATTACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-1172s1c1
Sequence:CCGGTCAAAGCCTGTGTTCGCTGTACTCGAGTACAGCGAACACAGGCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-854s1c1
Sequence:CCGGGCATGGACTTAGTAAATCTGTCTCGAGACAGATTTACTAAGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-857s1c1
Sequence:CCGGTGGACTTAGTAAATCTGTCTACTCGAGTAGACAGATTTACTAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025995.1-400s1c1
Sequence:CCGGGTGGGACATGATAACAAGGAACTCGAGTTCCTTGTTATCATGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012177
VALIDATED
FBXO5 MISSION shRNA Bacterial Glycerol Stock
F-box protein 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012177.x-1218s1c1
Sequence:CCGGTCGCTGTAATTCACCTGCAAACTCGAGTTTGCAGGTGAATTACAGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012177.x-1197s1c1
Sequence:CCGGCGAAAGCCTCAAAGCCTGTATCTCGAGATACAGGCTTTGAGGCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012177.x-628s1c1
Sequence:CCGGCCAGACCAATATCCCAACAAACTCGAGTTTGTTGGGATATTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012177.x-1529s1c1
Sequence:CCGGCGGTGTAGTATCCTGAGGTTTCTCGAGAAACCTCAGGATACTACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012177.x-179s1c1
Sequence:CCGGCGGATAGTTGTAAAGAAGAAACTCGAGTTTCTTCTTTACAACTATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012177.3-656s21c1
Sequence:CCGGCCAGACCAATATCCCAACAAACTCGAGTTTGTTGGGATATTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012177.3-1246s21c1
Sequence:CCGGTCGCTGTAATTCACCTGCAAACTCGAGTTTGCAGGTGAATTACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012177.3-1225s21c1
Sequence:CCGGCGAAAGCCTCAAAGCCTGTATCTCGAGATACAGGCTTTGAGGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012177.3-1557s21c1
Sequence:CCGGCGGTGTAGTATCCTGAGGTTTCTCGAGAAACCTCAGGATACTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012177
VALIDATED
FBXO5 MISSION shRNA shRNA Plasmid DNA
F-box protein 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012177.x-1218s1c1
Sequence:CCGGTCGCTGTAATTCACCTGCAAACTCGAGTTTGCAGGTGAATTACAGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012177.x-1197s1c1
Sequence:CCGGCGAAAGCCTCAAAGCCTGTATCTCGAGATACAGGCTTTGAGGCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012177.x-628s1c1
Sequence:CCGGCCAGACCAATATCCCAACAAACTCGAGTTTGTTGGGATATTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012177.x-1529s1c1
Sequence:CCGGCGGTGTAGTATCCTGAGGTTTCTCGAGAAACCTCAGGATACTACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012177.x-179s1c1
Sequence:CCGGCGGATAGTTGTAAAGAAGAAACTCGAGTTTCTTCTTTACAACTATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012177.3-656s21c1
Sequence:CCGGCCAGACCAATATCCCAACAAACTCGAGTTTGTTGGGATATTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012177.3-1246s21c1
Sequence:CCGGTCGCTGTAATTCACCTGCAAACTCGAGTTTGCAGGTGAATTACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012177.3-1225s21c1
Sequence:CCGGCGAAAGCCTCAAAGCCTGTATCTCGAGATACAGGCTTTGAGGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012177.3-1557s21c1
Sequence:CCGGCGGTGTAGTATCCTGAGGTTTCTCGAGAAACCTCAGGATACTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012177
VALIDATED
FBXO5 MISSION shRNA Lentiviral Transduction Particles
F-box protein 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012177.x-1218s1c1
Sequence:CCGGTCGCTGTAATTCACCTGCAAACTCGAGTTTGCAGGTGAATTACAGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012177.x-1197s1c1
Sequence:CCGGCGAAAGCCTCAAAGCCTGTATCTCGAGATACAGGCTTTGAGGCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012177.x-628s1c1
Sequence:CCGGCCAGACCAATATCCCAACAAACTCGAGTTTGTTGGGATATTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012177.x-1529s1c1
Sequence:CCGGCGGTGTAGTATCCTGAGGTTTCTCGAGAAACCTCAGGATACTACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012177.x-179s1c1
Sequence:CCGGCGGATAGTTGTAAAGAAGAAACTCGAGTTTCTTCTTTACAACTATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012177.3-656s21c1
Sequence:CCGGCCAGACCAATATCCCAACAAACTCGAGTTTGTTGGGATATTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012177.3-1246s21c1
Sequence:CCGGTCGCTGTAATTCACCTGCAAACTCGAGTTTGCAGGTGAATTACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012177.3-1225s21c1
Sequence:CCGGCGAAAGCCTCAAAGCCTGTATCTCGAGATACAGGCTTTGAGGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012177.3-1557s21c1
Sequence:CCGGCGGTGTAGTATCCTGAGGTTTCTCGAGAAACCTCAGGATACTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks