EMAIL THIS PAGE TO A FRIEND

FBXO6

F-box protein 6

60 Gene Product Result for
Synonyms: FBG2 FBS2 FBX6 Fbx6b
UniProtKB ID: Q9NRD1, B1AK42, B2RC88, Q9UKT3
Gene ID:
Human(26270) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class, and its C-terminal region is highly similar to that of rat NFB42 (neural F Box 42 kDa) which may be involved in the control of the cell cycle. [provided by RefSeq, Jul 2008]
Mouse(50762) F-box protein 6
Rat(192351) F-box protein 6
sheep(101112337) F-box protein 6
naked mole-rat(101723682) F-box protein 6
chicken(419494) F-box protein 6
dog(487444) F-box protein 6
cow(513023) F-box protein 6
domestic cat(101100065) F-box protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018438 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030491 MISSION® esiRNA esiRNA human FBXO6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018438 Rosetta Predictions human pricing
NM_138917 Rosetta Predictions rat pricing
NM_015797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116190 predicted 418
2 SASI_Hs01_00116191 predicted 780
3 SASI_Hs01_00116192 predicted 417
4 SASI_Hs01_00116193 predicted 727
5 SASI_Hs02_00351967 predicted 637
6 SASI_Hs01_00116195 predicted 882
7 SASI_Hs01_00116196 predicted 536
8 SASI_Hs01_00116197 predicted 568
9 SASI_Hs02_00351968 predicted 777
10 SASI_Hs01_00116198 predicted 621
11 SASI_Hs01_00116194 predicted 433
12 SASI_Hs01_00116199 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268401 predicted 509
2 SASI_Rn01_00071958 predicted 203
3 SASI_Rn01_00071959 predicted 469
4 SASI_Rn01_00071960 predicted 396
5 SASI_Rn01_00071962 predicted 406
6 SASI_Rn01_00071963 predicted 594
7 SASI_Rn01_00071964 predicted 346
8 SASI_Rn01_00071965 predicted 524
9 SASI_Rn02_00268402 predicted 366
10 SASI_Rn02_00268403 predicted 579
11 SASI_Rn01_00071957 predicted 749
12 SASI_Rn01_00071961 predicted 490
13 SASI_Rn01_00071966 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323164 predicted 1443
2 SASI_Mm01_00026709 predicted 1040
3 SASI_Mm02_00323165 predicted 1581
4 SASI_Mm02_00323166 predicted 1673
5 SASI_Mm01_00026710 predicted 1033
6 SASI_Mm01_00026711 predicted 961
7 SASI_Mm01_00026712 predicted 1355
8 SASI_Mm01_00026713 predicted 993
9 SASI_Mm02_00323167 predicted 1567
10 SASI_Mm02_00323168 predicted 1693
11 SASI_Mm01_00026707 predicted 967
12 SASI_Mm01_00026708 predicted 812
13 SASI_Mm01_00026714 predicted 345
14 SASI_Mm01_00026715 predicted 1027
15 SASI_Mm01_00026716 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018438
FBXO6 MISSION shRNA Bacterial Glycerol Stock
F-box protein 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018438.5-731s21c1
Sequence:CCGGTCGGCTGACTACTTCGTGTTGCTCGAGCAACACGAAGTAGTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018438.5-202s21c1
Sequence:CCGGCATTAACGAGCTGCCCGAGAACTCGAGTTCTCGGGCAGCTCGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018438.5-629s21c1
Sequence:CCGGGAGGAGCTACTAGACACATTCCTCGAGGAATGTGTCTAGTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018438.2-1135s1c1
Sequence:CCGGTGTGGTAACTTACTGTCACATCTCGAGATGTGACAGTAAGTTACCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-412s1c1
Sequence:CCGGTGTGCTGAAGAGGATATGTTTCTCGAGAAACATATCCTCTTCAGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-433s1c1
Sequence:CCGGGCATGGCAAATTGATTTCAATCTCGAGATTGAAATCAATTTGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-542s1c1
Sequence:CCGGCCTACGAAATGTGCCTCAAGTCTCGAGACTTGAGGCACATTTCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-992s1c1
Sequence:CCGGACCGAGCTGTTGTCCAGATTTCTCGAGAAATCTGGACAACAGCTCGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018438
FBXO6 MISSION shRNA shRNA Plasmid DNA
F-box protein 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018438.5-731s21c1
Sequence:CCGGTCGGCTGACTACTTCGTGTTGCTCGAGCAACACGAAGTAGTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018438.5-202s21c1
Sequence:CCGGCATTAACGAGCTGCCCGAGAACTCGAGTTCTCGGGCAGCTCGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018438.5-629s21c1
Sequence:CCGGGAGGAGCTACTAGACACATTCCTCGAGGAATGTGTCTAGTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018438.2-1135s1c1
Sequence:CCGGTGTGGTAACTTACTGTCACATCTCGAGATGTGACAGTAAGTTACCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-412s1c1
Sequence:CCGGTGTGCTGAAGAGGATATGTTTCTCGAGAAACATATCCTCTTCAGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-433s1c1
Sequence:CCGGGCATGGCAAATTGATTTCAATCTCGAGATTGAAATCAATTTGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-542s1c1
Sequence:CCGGCCTACGAAATGTGCCTCAAGTCTCGAGACTTGAGGCACATTTCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-992s1c1
Sequence:CCGGACCGAGCTGTTGTCCAGATTTCTCGAGAAATCTGGACAACAGCTCGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018438
FBXO6 MISSION shRNA Lentiviral Transduction Particles
F-box protein 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018438.5-731s21c1
Sequence:CCGGTCGGCTGACTACTTCGTGTTGCTCGAGCAACACGAAGTAGTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018438.5-202s21c1
Sequence:CCGGCATTAACGAGCTGCCCGAGAACTCGAGTTCTCGGGCAGCTCGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018438.5-629s21c1
Sequence:CCGGGAGGAGCTACTAGACACATTCCTCGAGGAATGTGTCTAGTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018438.2-1135s1c1
Sequence:CCGGTGTGGTAACTTACTGTCACATCTCGAGATGTGACAGTAAGTTACCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-412s1c1
Sequence:CCGGTGTGCTGAAGAGGATATGTTTCTCGAGAAACATATCCTCTTCAGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-433s1c1
Sequence:CCGGGCATGGCAAATTGATTTCAATCTCGAGATTGAAATCAATTTGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-542s1c1
Sequence:CCGGCCTACGAAATGTGCCTCAAGTCTCGAGACTTGAGGCACATTTCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018438.2-992s1c1
Sequence:CCGGACCGAGCTGTTGTCCAGATTTCTCGAGAAATCTGGACAACAGCTCGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015797
VALIDATED
FBXO6 MISSION shRNA Bacterial Glycerol Stock
F-box protein 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015797.3-1761s21c1
Sequence:CCGGCCATGAGCACTTGCCCTATACCTCGAGGTATAGGGCAAGTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1202s21c1
Sequence:CCGGCAACAAGGTCAAGAAGTATTTCTCGAGAAATACTTCTTGACCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1043s21c1
Sequence:CCGGAGACTGGAAGGTCTTCTATATCTCGAGATATAGAAGACCTTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1637s21c1
Sequence:CCGGACCGGAAGAAACTGTAGTAATCTCGAGATTACTACAGTTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1310s21c1
Sequence:CCGGGCCTGACATTGTGGTTAAGGACTCGAGTCCTTAACCACAATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015797.1-852s1c1
Sequence:CCGGGCAAGAGATTTCCCACACCTTCTCGAGAAGGTGTGGGAAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015797.1-1026s1c1
Sequence:CCGGACCGGAAGAAACTGTAGTAATCTCGAGATTACTACAGTTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015797.1-699s1c1
Sequence:CCGGGCCTGACATTGTGGTTAAGGACTCGAGTCCTTAACCACAATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015797.1-1024s1c1
Sequence:CCGGCTACCGGAAGAAACTGTAGTACTCGAGTACTACAGTTTCTTCCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015797.1-828s1c1
Sequence:CCGGCCAACAATGGAATGATGCCAACTCGAGTTGGCATCATTCCATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015797
VALIDATED
FBXO6 MISSION shRNA shRNA Plasmid DNA
F-box protein 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015797.3-1761s21c1
Sequence:CCGGCCATGAGCACTTGCCCTATACCTCGAGGTATAGGGCAAGTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1202s21c1
Sequence:CCGGCAACAAGGTCAAGAAGTATTTCTCGAGAAATACTTCTTGACCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1043s21c1
Sequence:CCGGAGACTGGAAGGTCTTCTATATCTCGAGATATAGAAGACCTTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1637s21c1
Sequence:CCGGACCGGAAGAAACTGTAGTAATCTCGAGATTACTACAGTTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1310s21c1
Sequence:CCGGGCCTGACATTGTGGTTAAGGACTCGAGTCCTTAACCACAATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015797.1-852s1c1
Sequence:CCGGGCAAGAGATTTCCCACACCTTCTCGAGAAGGTGTGGGAAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015797.1-1026s1c1
Sequence:CCGGACCGGAAGAAACTGTAGTAATCTCGAGATTACTACAGTTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015797.1-699s1c1
Sequence:CCGGGCCTGACATTGTGGTTAAGGACTCGAGTCCTTAACCACAATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015797.1-1024s1c1
Sequence:CCGGCTACCGGAAGAAACTGTAGTACTCGAGTACTACAGTTTCTTCCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015797.1-828s1c1
Sequence:CCGGCCAACAATGGAATGATGCCAACTCGAGTTGGCATCATTCCATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015797
VALIDATED
FBXO6 MISSION shRNA Lentiviral Transduction Particles
F-box protein 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015797.3-1761s21c1
Sequence:CCGGCCATGAGCACTTGCCCTATACCTCGAGGTATAGGGCAAGTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1202s21c1
Sequence:CCGGCAACAAGGTCAAGAAGTATTTCTCGAGAAATACTTCTTGACCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1043s21c1
Sequence:CCGGAGACTGGAAGGTCTTCTATATCTCGAGATATAGAAGACCTTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1637s21c1
Sequence:CCGGACCGGAAGAAACTGTAGTAATCTCGAGATTACTACAGTTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015797.3-1310s21c1
Sequence:CCGGGCCTGACATTGTGGTTAAGGACTCGAGTCCTTAACCACAATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015797.1-852s1c1
Sequence:CCGGGCAAGAGATTTCCCACACCTTCTCGAGAAGGTGTGGGAAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015797.1-1026s1c1
Sequence:CCGGACCGGAAGAAACTGTAGTAATCTCGAGATTACTACAGTTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015797.1-699s1c1
Sequence:CCGGGCCTGACATTGTGGTTAAGGACTCGAGTCCTTAACCACAATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015797.1-1024s1c1
Sequence:CCGGCTACCGGAAGAAACTGTAGTACTCGAGTACTACAGTTTCTTCCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015797.1-828s1c1
Sequence:CCGGCCAACAATGGAATGATGCCAACTCGAGTTGGCATCATTCCATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks