EMAIL THIS PAGE TO A FRIEND

FBXO7

F-box protein 7

Synonyms: FBX FBX07 FBX7 PARK15 PKPS
Gene ID:
Human(25793) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it may play a role in regulation of hematopoiesis. Alternatively spliced transcript variants of this gene have been identified with the full-length natures of only some variants being determined. [provided by RefSeq, Jul 2008]
Mouse(69754) F-box protein 7
Rat(366854) F-box protein 7
Zebrafish(558097) F-box protein 7
chicken(418063) F-box protein 7
cow(508235) F-box protein 7
domestic cat(101090705) F-box protein 7
dog(474522) F-box protein 7
naked mole-rat(101716349) F-box protein 7
sheep(101118684) F-box protein 7
Domestic Rabbit(100328739) F-box protein 7
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012179 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033024 Rosetta Predictions human pricing
NM_012179 Rosetta Predictions human pricing
NM_001012222 Rosetta Predictions rat pricing
XM_576203 Rosetta Predictions rat pricing
NM_153195 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216174 predicted 474
2 SASI_Hs01_00216175 predicted 1447
3 SASI_Hs01_00216176 predicted 432
4 SASI_Hs02_00307968 predicted 848
5 SASI_Hs01_00216177 predicted 784
6 SASI_Hs01_00216178 predicted 1048
7 SASI_Hs01_00216179 predicted 1324
8 SASI_Hs01_00216180 predicted 1245
9 SASI_Hs01_00216182 predicted 770
10 SASI_Hs01_00216183 predicted 645
11 SASI_Hs01_00216181 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219796 predicted 866
2 SASI_Hs01_00219797 predicted 1850
3 SASI_Hs01_00219798 predicted 831
4 SASI_Hs02_00343793 predicted 1248
5 SASI_Hs01_00219799 predicted 1181
6 SASI_Hs01_00219800 predicted 1446
7 SASI_Hs01_00219801 predicted 1717
8 SASI_Hs01_00219802 predicted 1638
9 SASI_Hs01_00219804 predicted 1164
10 SASI_Hs01_00219805 predicted 1049
11 SASI_Hs01_00219803 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087181 predicted 1350
2 SASI_Rn01_00087182 predicted 913
3 SASI_Rn01_00087183 predicted 1151
4 SASI_Rn01_00087184 predicted 1351
5 SASI_Rn01_00087185 predicted 379
6 SASI_Rn01_00087186 predicted 899
7 SASI_Rn02_00200480 predicted 1204
8 SASI_Rn01_00087187 predicted 725
9 SASI_Rn01_00087188 predicted 1385
10 SASI_Rn01_00087190 predicted 245
11 SASI_Rn01_00087189 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164838 predicted 1356
2 SASI_Rn01_00164839 predicted 919
3 SASI_Rn01_00164840 predicted 1153
4 SASI_Rn01_00164841 predicted 1363
5 SASI_Rn01_00164842 predicted 380
6 SASI_Rn01_00164843 predicted 913
7 SASI_Rn01_00164844 predicted 727
8 SASI_Rn01_00164845 predicted 1388
9 SASI_Rn01_00164846 predicted 630
10 SASI_Rn01_00164847 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158109 predicted 1418
2 SASI_Mm01_00158110 predicted 494
3 SASI_Mm01_00158111 predicted 434
4 SASI_Mm01_00158112 predicted 1418
5 SASI_Mm01_00158113 predicted 1208
6 SASI_Mm02_00343113 predicted 223
7 SASI_Mm02_00343114 predicted 217
8 SASI_Mm01_00158114 predicted 309
9 SASI_Mm01_00158115 predicted 1214
10 SASI_Mm01_00158116 predicted 339
11 SASI_Mm01_00158117 predicted 1370
12 SASI_Mm01_00158118 predicted 684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153195
VALIDATED
FBXO7 MISSION shRNA Bacterial Glycerol Stock
F-box protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-1638s1c1
Sequence:CCGGGCTGTTTCCTTGGATGCTGATCTCGAGATCAGCATCCAAGGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-319s1c1
Sequence:CCGGCATTCCTCACTCCAGGATAATCTCGAGATTATCCTGGAGTGAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-796s1c1
Sequence:CCGGCCTTTGGGAAACTTAATCATTCTCGAGAATGATTAAGTTTCCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153195.1-1360s1c1
Sequence:CCGGCCAGGAATCATTGGTGGTGAACTCGAGTTCACCACCAATGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-284s1c1
Sequence:CCGGCGGCACCTAACTTACCTTCATCTCGAGATGAAGGTAAGTTAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153195
VALIDATED
FBXO7 MISSION shRNA shRNA Plasmid DNA
F-box protein 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-1638s1c1
Sequence:CCGGGCTGTTTCCTTGGATGCTGATCTCGAGATCAGCATCCAAGGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-319s1c1
Sequence:CCGGCATTCCTCACTCCAGGATAATCTCGAGATTATCCTGGAGTGAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-796s1c1
Sequence:CCGGCCTTTGGGAAACTTAATCATTCTCGAGAATGATTAAGTTTCCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153195.1-1360s1c1
Sequence:CCGGCCAGGAATCATTGGTGGTGAACTCGAGTTCACCACCAATGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-284s1c1
Sequence:CCGGCGGCACCTAACTTACCTTCATCTCGAGATGAAGGTAAGTTAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153195
VALIDATED
FBXO7 MISSION shRNA Lentiviral Transduction Particles
F-box protein 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-1638s1c1
Sequence:CCGGGCTGTTTCCTTGGATGCTGATCTCGAGATCAGCATCCAAGGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-319s1c1
Sequence:CCGGCATTCCTCACTCCAGGATAATCTCGAGATTATCCTGGAGTGAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-796s1c1
Sequence:CCGGCCTTTGGGAAACTTAATCATTCTCGAGAATGATTAAGTTTCCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153195.1-1360s1c1
Sequence:CCGGCCAGGAATCATTGGTGGTGAACTCGAGTTCACCACCAATGATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153195.1-284s1c1
Sequence:CCGGCGGCACCTAACTTACCTTCATCTCGAGATGAAGGTAAGTTAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012179
VALIDATED
FBXO7 MISSION shRNA Bacterial Glycerol Stock
F-box protein 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-531s1c1
Sequence:CCGGCGCCTAATATACCTTCATCCACTCGAGTGGATGAAGGTATATTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-2071s1c1
Sequence:CCGGCCCTGCTCTTGGTTCTCCTCTCTCGAGAGAGGAGAACCAAGAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-848s1c1
Sequence:CCGGGCTGACTGTTCTGATGCCAATCTCGAGATTGGCATCAGAACAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-817s1c1
Sequence:CCGGGCCACATTCATTAGAGACCTTCTCGAGAAGGTCTCTAATGAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-1526s1c1
Sequence:CCGGCCATCGTCAACTCACACCATTCTCGAGAATGGTGTGAGTTGACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-820s21c1
Sequence:CCGGGCCACATTCATTAGAGACCTTCTCGAGAAGGTCTCTAATGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-635s21c1
Sequence:CCGGGAACAACCAAGTGATTCATTCCTCGAGGAATGAATCACTTGGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012179.3-1960s21c1
Sequence:CCGGGAGAGTTGCACTCCCAGAAACCTCGAGGTTTCTGGGAGTGCAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-1839s21c1
Sequence:CCGGTGTCATTCATGTGATTGATTTCTCGAGAAATCAATCACATGAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-903s21c1
Sequence:CCGGTGTTGGAGTCAGGTTACATACCTCGAGGTATGTAACCTGACTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012179
VALIDATED
FBXO7 MISSION shRNA shRNA Plasmid DNA
F-box protein 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-531s1c1
Sequence:CCGGCGCCTAATATACCTTCATCCACTCGAGTGGATGAAGGTATATTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-2071s1c1
Sequence:CCGGCCCTGCTCTTGGTTCTCCTCTCTCGAGAGAGGAGAACCAAGAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-848s1c1
Sequence:CCGGGCTGACTGTTCTGATGCCAATCTCGAGATTGGCATCAGAACAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-817s1c1
Sequence:CCGGGCCACATTCATTAGAGACCTTCTCGAGAAGGTCTCTAATGAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-1526s1c1
Sequence:CCGGCCATCGTCAACTCACACCATTCTCGAGAATGGTGTGAGTTGACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-820s21c1
Sequence:CCGGGCCACATTCATTAGAGACCTTCTCGAGAAGGTCTCTAATGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-635s21c1
Sequence:CCGGGAACAACCAAGTGATTCATTCCTCGAGGAATGAATCACTTGGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012179.3-1960s21c1
Sequence:CCGGGAGAGTTGCACTCCCAGAAACCTCGAGGTTTCTGGGAGTGCAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-1839s21c1
Sequence:CCGGTGTCATTCATGTGATTGATTTCTCGAGAAATCAATCACATGAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-903s21c1
Sequence:CCGGTGTTGGAGTCAGGTTACATACCTCGAGGTATGTAACCTGACTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012179
VALIDATED
FBXO7 MISSION shRNA Lentiviral Transduction Particles
F-box protein 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-531s1c1
Sequence:CCGGCGCCTAATATACCTTCATCCACTCGAGTGGATGAAGGTATATTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-2071s1c1
Sequence:CCGGCCCTGCTCTTGGTTCTCCTCTCTCGAGAGAGGAGAACCAAGAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-848s1c1
Sequence:CCGGGCTGACTGTTCTGATGCCAATCTCGAGATTGGCATCAGAACAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-817s1c1
Sequence:CCGGGCCACATTCATTAGAGACCTTCTCGAGAAGGTCTCTAATGAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012179.x-1526s1c1
Sequence:CCGGCCATCGTCAACTCACACCATTCTCGAGAATGGTGTGAGTTGACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-820s21c1
Sequence:CCGGGCCACATTCATTAGAGACCTTCTCGAGAAGGTCTCTAATGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-635s21c1
Sequence:CCGGGAACAACCAAGTGATTCATTCCTCGAGGAATGAATCACTTGGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012179.3-1960s21c1
Sequence:CCGGGAGAGTTGCACTCCCAGAAACCTCGAGGTTTCTGGGAGTGCAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-1839s21c1
Sequence:CCGGTGTCATTCATGTGATTGATTTCTCGAGAAATCAATCACATGAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012179.3-903s21c1
Sequence:CCGGTGTTGGAGTCAGGTTACATACCTCGAGGTATGTAACCTGACTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks