EMAIL THIS PAGE TO A FRIEND

FBXO8

F-box protein 8

120 Gene Product Result for
Synonyms: FBS FBX8
UniProtKB ID: Q9NRD0, B2RB40, D3DP41, Q6UWN4, Q9NRP5, Q9UKC4
Gene ID:
Human(26269) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It contains a C-terminal amino acid sequence that bears a significant similarity with a portion of yeast Sec7p, a critical regulator of vesicular protein transport. This human protein may interact with ADP-ribosylation factor(s)(ARFs) and exhibit ARF-GEF (guanine nucleotide exchange factor) activity. [provided by RefSeq, Jul 2008]
Mouse(50753) F-box protein 8
Rat(306436) F-box protein 8
sheep(101119879) F-box protein 8
Domestic Rabbit(100358150) F-box protein 8
naked mole-rat(101713357) F-box protein 8
Zebrafish(678549) F-box protein 8
cow(538528) F-box protein 8
Horse(100061095) F-box protein 8
domestic cat(101088075) F-box protein 8
dog(477359) F-box protein 8
chicken(422565) F-box protein 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012180 Rosetta Predictions human pricing
NM_001012050 Rosetta Predictions rat pricing
XM_573904 Rosetta Predictions rat pricing
NM_015791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216324 predicted 1071
2 SASI_Hs01_00216325 predicted 1404
3 SASI_Hs01_00216326 predicted 1306
4 SASI_Hs01_00216327 predicted 994
5 SASI_Hs01_00216328 predicted 1587
6 SASI_Hs01_00216329 predicted 1436
7 SASI_Hs01_00216330 predicted 950
8 SASI_Hs02_00343794 predicted 967
9 SASI_Hs01_00216332 predicted 1459
10 SASI_Hs01_00216333 predicted 1154
11 SASI_Hs01_00216331 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104647 predicted 1041
2 SASI_Rn01_00104648 predicted 776
3 SASI_Rn01_00104649 predicted 944
4 SASI_Rn01_00104650 predicted 1066
5 SASI_Rn01_00104651 predicted 592
6 SASI_Rn02_00200154 predicted 910
7 SASI_Rn01_00104653 predicted 1153
8 SASI_Rn01_00104654 predicted 589
9 SASI_Rn02_00200155 predicted 1243
10 SASI_Rn02_00200156 predicted 1152
11 SASI_Rn01_00104645 predicted 858
12 SASI_Rn01_00104646 predicted 1186
13 SASI_Rn01_00104652 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131013 predicted 630
2 SASI_Rn01_00131014 predicted 960
3 SASI_Rn01_00131015 predicted 821
4 SASI_Rn01_00131016 predicted 551
5 SASI_Rn01_00131017 predicted 715
6 SASI_Rn01_00131018 predicted 846
7 SASI_Rn01_00131019 predicted 365
8 SASI_Rn01_00131020 predicted 685
9 SASI_Rn01_00131021 predicted 941
10 SASI_Rn01_00131022 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167550 predicted 1211
2 SASI_Mm01_00167551 predicted 390
3 SASI_Mm01_00167552 predicted 1062
4 SASI_Mm01_00167553 predicted 844
5 SASI_Mm02_00323152 predicted 801
6 SASI_Mm02_00323153 predicted 277
7 SASI_Mm01_00167555 predicted 558
8 SASI_Mm01_00167556 predicted 1181
9 SASI_Mm01_00167557 predicted 664
10 SASI_Mm01_00167559 predicted 859
11 SASI_Mm01_00167554 predicted 1026
12 SASI_Mm01_00167558 predicted 519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012180
VALIDATED
FBXO8 MISSION shRNA Bacterial Glycerol Stock
F-box protein 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012180.2-1443s21c1
Sequence:CCGGACCTTGTAACATTGCATAATTCTCGAGAATTATGCAATGTTACAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012180.2-992s21c1
Sequence:CCGGCAAGGAGGCATTGACATATATCTCGAGATATATGTCAATGCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012180.2-2284s21c1
Sequence:CCGGTGAAACTATTGTCTTCGTAAACTCGAGTTTACGAAGACAATAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012180.1-1005s1c1
Sequence:CCGGCCTGATTTAATGCGAGAACTTCTCGAGAAGTTCTCGCATTAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012180.1-949s1c1
Sequence:CCGGGAGAGTATCTTGAAACTCTTACTCGAGTAAGAGTTTCAAGATACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012180.1-620s1c1
Sequence:CCGGCTGGTCCATATACAATAAGAACTCGAGTTCTTATTGTATATGGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012180.1-731s1c1
Sequence:CCGGCTACTTTATGTCCAAGGGTATCTCGAGATACCCTTGGACATAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012180.1-381s1c1
Sequence:CCGGTCTAACACCAATCATCGTAAACTCGAGTTTACGATGATTGGTGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012180
VALIDATED
FBXO8 MISSION shRNA shRNA Plasmid DNA
F-box protein 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012180.2-1443s21c1
Sequence:CCGGACCTTGTAACATTGCATAATTCTCGAGAATTATGCAATGTTACAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012180.2-992s21c1
Sequence:CCGGCAAGGAGGCATTGACATATATCTCGAGATATATGTCAATGCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012180.2-2284s21c1
Sequence:CCGGTGAAACTATTGTCTTCGTAAACTCGAGTTTACGAAGACAATAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012180.1-1005s1c1
Sequence:CCGGCCTGATTTAATGCGAGAACTTCTCGAGAAGTTCTCGCATTAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012180.1-949s1c1
Sequence:CCGGGAGAGTATCTTGAAACTCTTACTCGAGTAAGAGTTTCAAGATACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012180.1-620s1c1
Sequence:CCGGCTGGTCCATATACAATAAGAACTCGAGTTCTTATTGTATATGGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012180.1-731s1c1
Sequence:CCGGCTACTTTATGTCCAAGGGTATCTCGAGATACCCTTGGACATAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012180.1-381s1c1
Sequence:CCGGTCTAACACCAATCATCGTAAACTCGAGTTTACGATGATTGGTGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012180
VALIDATED
FBXO8 MISSION shRNA Lentiviral Transduction Particles
F-box protein 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012180.2-1443s21c1
Sequence:CCGGACCTTGTAACATTGCATAATTCTCGAGAATTATGCAATGTTACAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012180.2-992s21c1
Sequence:CCGGCAAGGAGGCATTGACATATATCTCGAGATATATGTCAATGCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012180.2-2284s21c1
Sequence:CCGGTGAAACTATTGTCTTCGTAAACTCGAGTTTACGAAGACAATAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012180.1-1005s1c1
Sequence:CCGGCCTGATTTAATGCGAGAACTTCTCGAGAAGTTCTCGCATTAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012180.1-949s1c1
Sequence:CCGGGAGAGTATCTTGAAACTCTTACTCGAGTAAGAGTTTCAAGATACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012180.1-620s1c1
Sequence:CCGGCTGGTCCATATACAATAAGAACTCGAGTTCTTATTGTATATGGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012180.1-731s1c1
Sequence:CCGGCTACTTTATGTCCAAGGGTATCTCGAGATACCCTTGGACATAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012180.1-381s1c1
Sequence:CCGGTCTAACACCAATCATCGTAAACTCGAGTTTACGATGATTGGTGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015791
VALIDATED
FBXO8 MISSION shRNA Bacterial Glycerol Stock
F-box protein 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015791.3-389s21c1
Sequence:CCGGAGCCCAAGGAGGCATTGATATCTCGAGATATCAATGCCTCCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015791.3-1173s21c1
Sequence:CCGGTATGACAACATCTACCTTATTCTCGAGAATAAGGTAGATGTTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015791.3-935s1c1
Sequence:CCGGGGAGTACCTTGAAACTCTTATCTCGAGATAAGAGTTTCAAGGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015791.3-2006s1c1
Sequence:CCGGCTTGATCTCTTGATTAGTTAACTCGAGTTAACTAATCAAGAGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015791.3-2006s21c1
Sequence:CCGGCTTGATCTCTTGATTAGTTAACTCGAGTTAACTAATCAAGAGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015791.3-937s21c1
Sequence:CCGGAGTACCTTGAAACTCTTATAACTCGAGTTATAAGAGTTTCAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015791.3-703s21c1
Sequence:CCGGAGGAGGGAGTGAGCTACTTTACTCGAGTAAAGTAGCTCACTCCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015791.2-716s1c1
Sequence:CCGGGCTACTTTATGTCCAAGGGTACTCGAGTACCCTTGGACATAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015791
VALIDATED
FBXO8 MISSION shRNA shRNA Plasmid DNA
F-box protein 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015791.3-389s21c1
Sequence:CCGGAGCCCAAGGAGGCATTGATATCTCGAGATATCAATGCCTCCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015791.3-1173s21c1
Sequence:CCGGTATGACAACATCTACCTTATTCTCGAGAATAAGGTAGATGTTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015791.3-935s1c1
Sequence:CCGGGGAGTACCTTGAAACTCTTATCTCGAGATAAGAGTTTCAAGGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015791.3-2006s1c1
Sequence:CCGGCTTGATCTCTTGATTAGTTAACTCGAGTTAACTAATCAAGAGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015791.3-2006s21c1
Sequence:CCGGCTTGATCTCTTGATTAGTTAACTCGAGTTAACTAATCAAGAGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015791.3-937s21c1
Sequence:CCGGAGTACCTTGAAACTCTTATAACTCGAGTTATAAGAGTTTCAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015791.3-703s21c1
Sequence:CCGGAGGAGGGAGTGAGCTACTTTACTCGAGTAAAGTAGCTCACTCCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015791.2-716s1c1
Sequence:CCGGGCTACTTTATGTCCAAGGGTACTCGAGTACCCTTGGACATAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015791
VALIDATED
FBXO8 MISSION shRNA Lentiviral Transduction Particles
F-box protein 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015791.3-389s21c1
Sequence:CCGGAGCCCAAGGAGGCATTGATATCTCGAGATATCAATGCCTCCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015791.3-1173s21c1
Sequence:CCGGTATGACAACATCTACCTTATTCTCGAGAATAAGGTAGATGTTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015791.3-935s1c1
Sequence:CCGGGGAGTACCTTGAAACTCTTATCTCGAGATAAGAGTTTCAAGGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015791.3-2006s1c1
Sequence:CCGGCTTGATCTCTTGATTAGTTAACTCGAGTTAACTAATCAAGAGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015791.3-2006s21c1
Sequence:CCGGCTTGATCTCTTGATTAGTTAACTCGAGTTAACTAATCAAGAGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015791.3-937s21c1
Sequence:CCGGAGTACCTTGAAACTCTTATAACTCGAGTTATAAGAGTTTCAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015791.3-703s21c1
Sequence:CCGGAGGAGGGAGTGAGCTACTTTACTCGAGTAAAGTAGCTCACTCCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015791.2-716s1c1
Sequence:CCGGGCTACTTTATGTCCAAGGGTACTCGAGTACCCTTGGACATAAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks