EMAIL THIS PAGE TO A FRIEND

FBXO9

F-box protein 9

141 Gene Product Result for
Synonyms: FBX9 NY-REN-57 VCIA1 dJ341E18.2
Gene ID:
Human(26268) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates at least 3 transcript variants diverging at the 5' terminus. [provided by RefSeq, Jul 2008]
Mouse(71538) f-box protein 9
Rat(300849) f-box protein 9
Zebrafish(325469) F-box protein 9
chicken(421895) F-box protein 9
dog(474940) F-box protein 9
cow(511798) F-box protein 9
Horse(100069351) F-box protein 9
naked mole-rat(101716248) F-box protein 9
sheep(101107741) F-box protein 9
Domestic Rabbit(100355202) F-box protein 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012347 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012347 Rosetta Predictions human pricing
NM_033480 Rosetta Predictions human pricing
NM_033481 Rosetta Predictions human pricing
NM_001011998 Rosetta Predictions rat pricing
XM_576433 Rosetta Predictions rat pricing
NM_001081490 Rosetta Predictions mouse pricing
NM_023605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102640 predicted 930
2 SASI_Hs01_00102641 predicted 421
3 SASI_Hs01_00102642 predicted 1089
4 SASI_Hs01_00102643 predicted 1003
5 SASI_Hs01_00102644 predicted 669
6 SASI_Hs01_00102645 predicted 378
7 SASI_Hs01_00102646 predicted 401
8 SASI_Hs01_00102647 predicted 599
9 SASI_Hs01_00102649 predicted 967
10 SASI_Hs02_00344159 predicted 1025
11 SASI_Hs01_00102648 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116230 predicted 1175
2 SASI_Hs01_00116231 predicted 670
3 SASI_Hs01_00116232 predicted 1336
4 SASI_Hs01_00116233 predicted 1248
5 SASI_Hs01_00116234 predicted 927
6 SASI_Hs01_00116235 predicted 621
7 SASI_Hs01_00116236 predicted 652
8 SASI_Hs01_00116237 predicted 847
9 SASI_Hs01_00116239 predicted 1217
10 SASI_Hs02_00361351 predicted 1272
11 SASI_Hs01_00116238 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238695 predicted 1060
2 SASI_Hs01_00238696 predicted 544
3 SASI_Hs01_00238697 predicted 1213
4 SASI_Hs01_00238698 predicted 1131
5 SASI_Hs01_00238699 predicted 796
6 SASI_Hs01_00238700 predicted 499
7 SASI_Hs01_00238701 predicted 531
8 SASI_Hs01_00238702 predicted 719
9 SASI_Hs01_00238704 predicted 1087
10 SASI_Hs02_00361352 predicted 1151
11 SASI_Hs01_00238703 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046100 predicted 1037
2 SASI_Rn01_00046101 predicted 1298
3 SASI_Rn01_00046102 predicted 1119
4 SASI_Rn01_00046103 predicted 1096
5 SASI_Rn01_00046104 predicted 673
6 SASI_Rn01_00046105 predicted 1325
7 SASI_Rn01_00046106 predicted 531
8 SASI_Rn01_00046107 predicted 1525
9 SASI_Rn01_00046108 predicted 1292
10 SASI_Rn01_00046109 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00155392 predicted 862
2 SASI_Rn01_00155393 predicted 956
3 SASI_Rn01_00155394 predicted 922
4 SASI_Rn01_00155395 predicted 775
5 SASI_Rn01_00155396 predicted 885
6 SASI_Rn01_00155397 predicted 776
7 SASI_Rn01_00155398 predicted 919
8 SASI_Rn01_00155399 predicted 675
9 SASI_Rn01_00155400 predicted 970
10 SASI_Rn01_00155401 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298610 predicted 388
2 SASI_Mm02_00298611 predicted 742
3 SASI_Mm02_00298612 predicted 1020
4 SASI_Mm02_00298613 predicted 809
5 SASI_Mm02_00298614 predicted 1029
6 SASI_Mm02_00298615 predicted 835
7 SASI_Mm02_00298616 predicted 257
8 SASI_Mm02_00298617 predicted 339
9 SASI_Mm02_00298618 predicted 1245
10 SASI_Mm02_00298619 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027178 predicted 700
2 SASI_Mm01_00027179 predicted 1060
3 SASI_Mm01_00027180 predicted 1337
4 SASI_Mm01_00027181 predicted 1118
5 SASI_Mm01_00027182 predicted 1348
6 SASI_Mm01_00027183 predicted 1150
7 SASI_Mm01_00027184 predicted 565
8 SASI_Mm01_00027186 predicted 651
9 SASI_Mm02_00327209 predicted 1561
10 SASI_Mm02_00327210 predicted 1326
11 SASI_Mm01_00027177 predicted 1343
12 SASI_Mm01_00027185 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023605
VALIDATED
FBXO9 MISSION shRNA Bacterial Glycerol Stock
F-box protein 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023605.1-843s1c1
Sequence:CCGGGAGACCAGTCAGACTCACATACTCGAGTATGTGAGTCTGACTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023605.1-1346s1c1
Sequence:CCGGCCAAAGTCTTTGCTGTAATAACTCGAGTTATTACAGCAAAGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023605.1-1032s1c1
Sequence:CCGGCTGCATGAAGCTCGTTCCATACTCGAGTATGGAACGAGCTTCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023605.1-1059s1c1
Sequence:CCGGCTGGAGAGAGATGTTTCTAGACTCGAGTCTAGAAACATCTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023605.2-1089s21c1
Sequence:CCGGCTGGAGAGAGATGTTTCTAGACTCGAGTCTAGAAACATCTCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023605.2-1784s21c1
Sequence:CCGGATGGAGTTGGAGCTTACTTTACTCGAGTAAAGTAAGCTCCAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023605.2-1062s21c1
Sequence:CCGGCTGCATGAAGCTCGTTCCATACTCGAGTATGGAACGAGCTTCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023605.2-709s21c1
Sequence:CCGGATTGAGTTCAAGATCACTTACCTCGAGGTAAGTGATCTTGAACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023605.2-1376s21c1
Sequence:CCGGCCAAAGTCTTTGCTGTAATAACTCGAGTTATTACAGCAAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023605
VALIDATED
FBXO9 MISSION shRNA shRNA Plasmid DNA
F-box protein 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023605.1-843s1c1
Sequence:CCGGGAGACCAGTCAGACTCACATACTCGAGTATGTGAGTCTGACTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023605.1-1346s1c1
Sequence:CCGGCCAAAGTCTTTGCTGTAATAACTCGAGTTATTACAGCAAAGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023605.1-1032s1c1
Sequence:CCGGCTGCATGAAGCTCGTTCCATACTCGAGTATGGAACGAGCTTCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023605.1-1059s1c1
Sequence:CCGGCTGGAGAGAGATGTTTCTAGACTCGAGTCTAGAAACATCTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023605.2-1089s21c1
Sequence:CCGGCTGGAGAGAGATGTTTCTAGACTCGAGTCTAGAAACATCTCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023605.2-1784s21c1
Sequence:CCGGATGGAGTTGGAGCTTACTTTACTCGAGTAAAGTAAGCTCCAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023605.2-1062s21c1
Sequence:CCGGCTGCATGAAGCTCGTTCCATACTCGAGTATGGAACGAGCTTCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023605.2-709s21c1
Sequence:CCGGATTGAGTTCAAGATCACTTACCTCGAGGTAAGTGATCTTGAACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023605.2-1376s21c1
Sequence:CCGGCCAAAGTCTTTGCTGTAATAACTCGAGTTATTACAGCAAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023605
VALIDATED
FBXO9 MISSION shRNA Lentiviral Transduction Particles
F-box protein 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023605.1-843s1c1
Sequence:CCGGGAGACCAGTCAGACTCACATACTCGAGTATGTGAGTCTGACTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023605.1-1346s1c1
Sequence:CCGGCCAAAGTCTTTGCTGTAATAACTCGAGTTATTACAGCAAAGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023605.1-1032s1c1
Sequence:CCGGCTGCATGAAGCTCGTTCCATACTCGAGTATGGAACGAGCTTCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023605.1-1059s1c1
Sequence:CCGGCTGGAGAGAGATGTTTCTAGACTCGAGTCTAGAAACATCTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023605.2-1089s21c1
Sequence:CCGGCTGGAGAGAGATGTTTCTAGACTCGAGTCTAGAAACATCTCTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023605.2-1784s21c1
Sequence:CCGGATGGAGTTGGAGCTTACTTTACTCGAGTAAAGTAAGCTCCAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023605.2-1062s21c1
Sequence:CCGGCTGCATGAAGCTCGTTCCATACTCGAGTATGGAACGAGCTTCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023605.2-709s21c1
Sequence:CCGGATTGAGTTCAAGATCACTTACCTCGAGGTAAGTGATCTTGAACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023605.2-1376s21c1
Sequence:CCGGCCAAAGTCTTTGCTGTAATAACTCGAGTTATTACAGCAAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012347
VALIDATED
FBXO9 MISSION shRNA Bacterial Glycerol Stock
F-box protein 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012347.2-1015s1c1
Sequence:CCGGCCACGTTTAAGAACTAGGAATCTCGAGATTCCTAGTTCTTAAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012347.2-217s1c1
Sequence:CCGGCCAGGTGTAAGCTCTAGCAATCTCGAGATTGCTAGAGCTTACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012347.2-424s1c1
Sequence:CCGGCCTGATATAGAGTTCAAGATTCTCGAGAATCTTGAACTCTATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012347.2-678s1c1
Sequence:CCGGCCTCAGATCATTGGAGCAGTTCTCGAGAACTGCTCCAATGATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012347.2-1233s1c1
Sequence:CCGGCCAGAGGTTCAACAAACTCATCTCGAGATGAGTTTGTTGAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012347.4-1820s21c1
Sequence:CCGGTATTTCCCGCATGGCATAATGCTCGAGCATTATGCCATGCGGGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012347.4-842s21c1
Sequence:CCGGTTCGGTTTGATGGCGTGTATACTCGAGTATACACGCCATCAAACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012347.4-1233s21c1
Sequence:CCGGCCAGAGGTTCAACAAACTCATCTCGAGATGAGTTTGTTGAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012347.4-678s21c1
Sequence:CCGGCCTCAGATCATTGGAGCAGTTCTCGAGAACTGCTCCAATGATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012347.4-932s21c1
Sequence:CCGGTGGAATATTACAGGTACATAACTCGAGTTATGTACCTGTAATATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012347
VALIDATED
FBXO9 MISSION shRNA shRNA Plasmid DNA
F-box protein 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012347.2-1015s1c1
Sequence:CCGGCCACGTTTAAGAACTAGGAATCTCGAGATTCCTAGTTCTTAAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012347.2-217s1c1
Sequence:CCGGCCAGGTGTAAGCTCTAGCAATCTCGAGATTGCTAGAGCTTACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012347.2-424s1c1
Sequence:CCGGCCTGATATAGAGTTCAAGATTCTCGAGAATCTTGAACTCTATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012347.2-678s1c1
Sequence:CCGGCCTCAGATCATTGGAGCAGTTCTCGAGAACTGCTCCAATGATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012347.2-1233s1c1
Sequence:CCGGCCAGAGGTTCAACAAACTCATCTCGAGATGAGTTTGTTGAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012347.4-1820s21c1
Sequence:CCGGTATTTCCCGCATGGCATAATGCTCGAGCATTATGCCATGCGGGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012347.4-842s21c1
Sequence:CCGGTTCGGTTTGATGGCGTGTATACTCGAGTATACACGCCATCAAACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012347.4-1233s21c1
Sequence:CCGGCCAGAGGTTCAACAAACTCATCTCGAGATGAGTTTGTTGAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012347.4-678s21c1
Sequence:CCGGCCTCAGATCATTGGAGCAGTTCTCGAGAACTGCTCCAATGATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012347.4-932s21c1
Sequence:CCGGTGGAATATTACAGGTACATAACTCGAGTTATGTACCTGTAATATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012347
VALIDATED
FBXO9 MISSION shRNA Lentiviral Transduction Particles
F-box protein 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012347.2-1015s1c1
Sequence:CCGGCCACGTTTAAGAACTAGGAATCTCGAGATTCCTAGTTCTTAAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012347.2-217s1c1
Sequence:CCGGCCAGGTGTAAGCTCTAGCAATCTCGAGATTGCTAGAGCTTACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012347.2-424s1c1
Sequence:CCGGCCTGATATAGAGTTCAAGATTCTCGAGAATCTTGAACTCTATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012347.2-678s1c1
Sequence:CCGGCCTCAGATCATTGGAGCAGTTCTCGAGAACTGCTCCAATGATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012347.2-1233s1c1
Sequence:CCGGCCAGAGGTTCAACAAACTCATCTCGAGATGAGTTTGTTGAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012347.4-1820s21c1
Sequence:CCGGTATTTCCCGCATGGCATAATGCTCGAGCATTATGCCATGCGGGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012347.4-842s21c1
Sequence:CCGGTTCGGTTTGATGGCGTGTATACTCGAGTATACACGCCATCAAACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012347.4-1233s21c1
Sequence:CCGGCCAGAGGTTCAACAAACTCATCTCGAGATGAGTTTGTTGAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012347.4-678s21c1
Sequence:CCGGCCTCAGATCATTGGAGCAGTTCTCGAGAACTGCTCCAATGATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012347.4-932s21c1
Sequence:CCGGTGGAATATTACAGGTACATAACTCGAGTTATGTACCTGTAATATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks