EMAIL THIS PAGE TO A FRIEND

FBXW10

F-box and WD repeat domain containing 10

49 Gene Product Result for
Synonyms: Fbw10 HREP SM25H2 SM2SH2
UniProtKB ID: Q5XX13, C9JRY8, C9JZD7, Q8TC00, Q9H0F0
Gene ID:
Human(10517) Summary: Members of the F-box protein family, such as FBXW10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(213980) F-box and WD-40 domain protein 10
Rat(303215) F-box and WD repeat domain containing 10
sheep(101106187) F-box and WD repeat domain containing 10
Domestic Rabbit(100358978) F-box and WD repeat domain containing 10
naked mole-rat(101714178) F-box and WD repeat domain containing 10
domestic guinea pig(100731178) F-box and WD repeat domain containing 10
chicken(417323) F-box and WD repeat domain containing 10
cow(511953) F-box and WD repeat domain containing 10
Horse(100073136) F-box and WD repeat domain containing 10
domestic cat(101090560) F-box and WD repeat domain containing 10
dog(479512) F-box and WD repeat domain containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031456 Rosetta Predictions human pricing
XM_220553 Rosetta Predictions rat pricing
NM_001033669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358871 predicted 1252
2 SASI_Hs01_00240256 predicted 1430
3 SASI_Hs01_00240259 predicted 3055
4 SASI_Hs02_00358872 predicted 1086
5 SASI_Hs02_00358873 predicted 1765
6 SASI_Hs01_00240260 predicted 320
7 SASI_Hs01_00240261 predicted 3013
8 SASI_Hs01_00240262 predicted 2853
9 SASI_Hs02_00358874 predicted 1723
10 SASI_Hs02_00358875 predicted 3060
11 SASI_Hs01_00240257 predicted 402
12 SASI_Hs01_00240258 predicted 386
13 SASI_Hs01_00240263 predicted 325
14 SASI_Hs01_00240264 predicted 623
15 SASI_Hs01_00240265 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166634 predicted 271
2 SASI_Rn01_00166635 predicted 270
3 SASI_Rn01_00166636 predicted 270
4 SASI_Rn01_00166637 predicted 223
5 SASI_Rn01_00166638 predicted 245
6 SASI_Rn01_00166639 predicted 267
7 SASI_Rn01_00166640 predicted 210
8 SASI_Rn01_00166641 predicted 259
9 SASI_Rn01_00166642 predicted 204
10 SASI_Rn01_00166643 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108080 predicted 2895
2 SASI_Mm01_00108081 predicted 1438
3 SASI_Mm01_00108082 predicted 1460
4 SASI_Mm01_00108083 predicted 2676
5 SASI_Mm02_00288962 predicted 854
6 SASI_Mm01_00108084 predicted 2510
7 SASI_Mm01_00108085 predicted 426
8 SASI_Mm01_00108086 predicted 2521
9 SASI_Mm01_00108087 predicted 2481
10 SASI_Mm01_00108088 predicted 1062
11 SASI_Mm01_00108089 predicted 1122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031456
FBXW10 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 10
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-490s1c1
Sequence:CCGGCGGATCAACCTCAGCAAGAAACTCGAGTTTCTTGCTGAGGTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-275s1c1
Sequence:CCGGGAACCGATTCCATCCCTCTATCTCGAGATAGAGGGATGGAATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-1477s1c1
Sequence:CCGGGTCCTGATAGAGGAGAGAAATCTCGAGATTTCTCTCCTCTATCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-1316s1c1
Sequence:CCGGCAAGAGGAATTGATCCTAATTCTCGAGAATTAGGATCAATTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-2334s1c1
Sequence:CCGGCAATGTTCTCATGTTCCAGTTCTCGAGAACTGGAACATGAGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-615s1c1
Sequence:CCGGCAAGGCGAATTATACTCTCTTCTCGAGAAGAGAGTATAATTCGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-913s1c1
Sequence:CCGGCGGTGTATATCCGAAATGAATCTCGAGATTCATTTCGGATATACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-2757s1c1
Sequence:CCGGCCAAACAGAAATTACTGATGTCTCGAGACATCAGTAATTTCTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-2356s1c1
Sequence:CCGGGAGCACATAAAGTGGCAGTATCTCGAGATACTGCCACTTTATGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-3157s1c1
Sequence:CCGGCGCATCTATACAGCCCTTGATCTCGAGATCAAGGGCTGTATAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-1716s1c1
Sequence:CCGGCGGGAGCTATGACCTAAGTATCTCGAGATACTTAGGTCATAGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031456
FBXW10 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 10
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-490s1c1
Sequence:CCGGCGGATCAACCTCAGCAAGAAACTCGAGTTTCTTGCTGAGGTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-275s1c1
Sequence:CCGGGAACCGATTCCATCCCTCTATCTCGAGATAGAGGGATGGAATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-1477s1c1
Sequence:CCGGGTCCTGATAGAGGAGAGAAATCTCGAGATTTCTCTCCTCTATCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-1316s1c1
Sequence:CCGGCAAGAGGAATTGATCCTAATTCTCGAGAATTAGGATCAATTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-2334s1c1
Sequence:CCGGCAATGTTCTCATGTTCCAGTTCTCGAGAACTGGAACATGAGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-615s1c1
Sequence:CCGGCAAGGCGAATTATACTCTCTTCTCGAGAAGAGAGTATAATTCGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-913s1c1
Sequence:CCGGCGGTGTATATCCGAAATGAATCTCGAGATTCATTTCGGATATACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-2757s1c1
Sequence:CCGGCCAAACAGAAATTACTGATGTCTCGAGACATCAGTAATTTCTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-2356s1c1
Sequence:CCGGGAGCACATAAAGTGGCAGTATCTCGAGATACTGCCACTTTATGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-3157s1c1
Sequence:CCGGCGCATCTATACAGCCCTTGATCTCGAGATCAAGGGCTGTATAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-1716s1c1
Sequence:CCGGCGGGAGCTATGACCTAAGTATCTCGAGATACTTAGGTCATAGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031456
FBXW10 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 10
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-490s1c1
Sequence:CCGGCGGATCAACCTCAGCAAGAAACTCGAGTTTCTTGCTGAGGTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-275s1c1
Sequence:CCGGGAACCGATTCCATCCCTCTATCTCGAGATAGAGGGATGGAATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-1477s1c1
Sequence:CCGGGTCCTGATAGAGGAGAGAAATCTCGAGATTTCTCTCCTCTATCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-1316s1c1
Sequence:CCGGCAAGAGGAATTGATCCTAATTCTCGAGAATTAGGATCAATTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-2334s1c1
Sequence:CCGGCAATGTTCTCATGTTCCAGTTCTCGAGAACTGGAACATGAGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-615s1c1
Sequence:CCGGCAAGGCGAATTATACTCTCTTCTCGAGAAGAGAGTATAATTCGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-913s1c1
Sequence:CCGGCGGTGTATATCCGAAATGAATCTCGAGATTCATTTCGGATATACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031456.2-2757s1c1
Sequence:CCGGCCAAACAGAAATTACTGATGTCTCGAGACATCAGTAATTTCTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-2356s1c1
Sequence:CCGGGAGCACATAAAGTGGCAGTATCTCGAGATACTGCCACTTTATGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-3157s1c1
Sequence:CCGGCGCATCTATACAGCCCTTGATCTCGAGATCAAGGGCTGTATAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031456.2-1716s1c1
Sequence:CCGGCGGGAGCTATGACCTAAGTATCTCGAGATACTTAGGTCATAGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033669
FBXW10 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-1552s1c1
Sequence:CCGGCGGAAGATCCACCTTCTAGATCTCGAGATCTAGAAGGTGGATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-1686s1c1
Sequence:CCGGCATAAGATACTGGGATGTGAACTCGAGTTCACATCCCAGTATCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-2592s1c1
Sequence:CCGGCCTTCTGACTATCAGTGCCTTCTCGAGAAGGCACTGATAGTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-2609s1c1
Sequence:CCGGCCTTGCAACAAGCCCACAATTCTCGAGAATTGTGGGCTTGTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-2894s1c1
Sequence:CCGGCCAAGGTCTCTGACAGCTTAACTCGAGTTAAGCTGTCAGAGACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033669
FBXW10 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-1552s1c1
Sequence:CCGGCGGAAGATCCACCTTCTAGATCTCGAGATCTAGAAGGTGGATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-1686s1c1
Sequence:CCGGCATAAGATACTGGGATGTGAACTCGAGTTCACATCCCAGTATCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-2592s1c1
Sequence:CCGGCCTTCTGACTATCAGTGCCTTCTCGAGAAGGCACTGATAGTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-2609s1c1
Sequence:CCGGCCTTGCAACAAGCCCACAATTCTCGAGAATTGTGGGCTTGTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-2894s1c1
Sequence:CCGGCCAAGGTCTCTGACAGCTTAACTCGAGTTAAGCTGTCAGAGACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033669
FBXW10 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-1552s1c1
Sequence:CCGGCGGAAGATCCACCTTCTAGATCTCGAGATCTAGAAGGTGGATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-1686s1c1
Sequence:CCGGCATAAGATACTGGGATGTGAACTCGAGTTCACATCCCAGTATCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-2592s1c1
Sequence:CCGGCCTTCTGACTATCAGTGCCTTCTCGAGAAGGCACTGATAGTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-2609s1c1
Sequence:CCGGCCTTGCAACAAGCCCACAATTCTCGAGAATTGTGGGCTTGTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033669.1-2894s1c1
Sequence:CCGGCCAAGGTCTCTGACAGCTTAACTCGAGTTAAGCTGTCAGAGACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks