EMAIL THIS PAGE TO A FRIEND

FBXW11

F-box and WD repeat domain containing 11

107 Gene Product Result for
Synonyms: BTRC2 BTRCP2 FBW1B FBXW1B Fbw11 Hos
UniProtKB ID: Q9UKB1, B2RC98, Q9P2S8, Q9P2S9, Q9Y4C6
Gene ID:
Human(23291) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008]
Mouse(103583) F-box and WD-40 domain protein 11
Rat(303024) F-box and WD repeat domain containing 11
chicken(416181) F-box and WD repeat domain containing 11
dog(479291) F-box and WD repeat domain containing 11
Horse(100069972) F-box and WD repeat domain containing 11
cow(540642) F-box and WD repeat domain containing 11
domestic cat(101094156) F-box and WD repeat domain containing 11
domestic guinea pig(100715997) F-box and WD repeat domain containing 11
naked mole-rat(101718253) F-box and WD repeat domain containing 11
sheep(101107136) F-box and WD repeat domain containing 11
Domestic Rabbit(100340737) F-box and WD repeat domain containing 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012300 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012300 Rosetta Predictions human pricing
NM_033644 Rosetta Predictions human pricing
NM_033645 Rosetta Predictions human pricing
NM_001106993 Rosetta Predictions rat pricing
NM_134015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064261 predicted 1230
2 SASI_Hs01_00064262 predicted 1060
3 SASI_Hs02_00344073 predicted 1045
4 SASI_Hs01_00064264 predicted 1613
5 SASI_Hs01_00064265 predicted 1330
6 SASI_Hs01_00064266 predicted 2006
7 SASI_Hs01_00064267 predicted 1847
8 SASI_Hs01_00064268 predicted 1471
9 SASI_Hs01_00064269 predicted 1651
10 SASI_Hs01_00064270 predicted 1095
11 SASI_Hs01_00064263 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043480 predicted 1184
2 SASI_Hs01_00043481 predicted 1019
3 SASI_Hs02_00361455 predicted 1005
4 SASI_Hs01_00043483 predicted 1571
5 SASI_Hs01_00043484 predicted 1286
6 SASI_Hs01_00043485 predicted 1968
7 SASI_Hs01_00043486 predicted 1805
8 SASI_Hs01_00043487 predicted 1428
9 SASI_Hs01_00043488 predicted 1613
10 SASI_Hs01_00043489 predicted 1052
11 SASI_Hs01_00043482 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010581 predicted 1128
2 SASI_Hs01_00010582 predicted 962
3 SASI_Hs02_00361456 predicted 939
4 SASI_Hs01_00010584 predicted 1511
5 SASI_Hs01_00010585 predicted 1223
6 SASI_Hs01_00010586 predicted 1898
7 SASI_Hs01_00010587 predicted 1746
8 SASI_Hs01_00010588 predicted 1367
9 SASI_Hs01_00010589 predicted 1544
10 SASI_Hs01_00010590 predicted 993
11 SASI_Hs01_00010583 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224426 predicted 1314
2 SASI_Rn02_00224427 predicted 1305
3 SASI_Rn02_00224428 predicted 1032
4 SASI_Rn02_00224429 predicted 1212
5 SASI_Rn02_00224430 predicted 1434
6 SASI_Rn02_00224431 predicted 716
7 SASI_Rn02_00224432 predicted 1380
8 SASI_Rn02_00224433 predicted 1225
9 SASI_Rn02_00224434 predicted 1201
10 SASI_Rn02_00224435 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021142 predicted 802
2 SASI_Mm01_00021143 predicted 1348
3 SASI_Mm01_00021144 predicted 292
4 SASI_Mm01_00021145 predicted 1172
5 SASI_Mm01_00021146 predicted 343
6 SASI_Mm01_00021147 predicted 1687
7 SASI_Mm02_00339176 predicted 335
8 SASI_Mm01_00021148 predicted 720
9 SASI_Mm01_00021149 predicted 936
10 SASI_Mm01_00021150 predicted 415
11 SASI_Mm01_00021151 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134015
VALIDATED
FBXW11 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134015.1-2047s1c1
Sequence:CCGGGCGCCTTGGTTTGGTACTAAACTCGAGTTTAGTACCAAACCAAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134015.1-388s1c1
Sequence:CCGGGCATGGACATATTAACTCTTACTCGAGTAAGAGTTAATATGTCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134015.1-443s1c1
Sequence:CCGGGCTTTACCAGAGCAAGGCTTACTCGAGTAAGCCTTGCTCTGGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134015.1-1602s1c1
Sequence:CCGGGCTCCCATGATGACACTATTTCTCGAGAAATAGTGTCATCATGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134015.1-850s1c1
Sequence:CCGGCCGGGACAACTCTATCAAGATCTCGAGATCTTGATAGAGTTGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-2047s21c1
Sequence:CCGGGCGCCTTGGTTTGGTACTAAACTCGAGTTTAGTACCAAACCAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134015.2-1602s21c1
Sequence:CCGGGCTCCCATGATGACACTATTTCTCGAGAAATAGTGTCATCATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-1350s21c1
Sequence:CCGGCCATCCGGTTATGGGATATTGCTCGAGCAATATCCCATAACCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-939s21c1
Sequence:CCGGAGTATGATGAGCGAGTCATTGCTCGAGCAATGACTCGCTCATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-417s21c1
Sequence:CCGGCCATGTTGCAGCGGGACTTTACTCGAGTAAAGTCCCGCTGCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134015
VALIDATED
FBXW11 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134015.1-2047s1c1
Sequence:CCGGGCGCCTTGGTTTGGTACTAAACTCGAGTTTAGTACCAAACCAAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134015.1-388s1c1
Sequence:CCGGGCATGGACATATTAACTCTTACTCGAGTAAGAGTTAATATGTCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134015.1-443s1c1
Sequence:CCGGGCTTTACCAGAGCAAGGCTTACTCGAGTAAGCCTTGCTCTGGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134015.1-1602s1c1
Sequence:CCGGGCTCCCATGATGACACTATTTCTCGAGAAATAGTGTCATCATGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134015.1-850s1c1
Sequence:CCGGCCGGGACAACTCTATCAAGATCTCGAGATCTTGATAGAGTTGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-2047s21c1
Sequence:CCGGGCGCCTTGGTTTGGTACTAAACTCGAGTTTAGTACCAAACCAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134015.2-1602s21c1
Sequence:CCGGGCTCCCATGATGACACTATTTCTCGAGAAATAGTGTCATCATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-1350s21c1
Sequence:CCGGCCATCCGGTTATGGGATATTGCTCGAGCAATATCCCATAACCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-939s21c1
Sequence:CCGGAGTATGATGAGCGAGTCATTGCTCGAGCAATGACTCGCTCATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-417s21c1
Sequence:CCGGCCATGTTGCAGCGGGACTTTACTCGAGTAAAGTCCCGCTGCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134015
VALIDATED
FBXW11 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134015.1-2047s1c1
Sequence:CCGGGCGCCTTGGTTTGGTACTAAACTCGAGTTTAGTACCAAACCAAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134015.1-388s1c1
Sequence:CCGGGCATGGACATATTAACTCTTACTCGAGTAAGAGTTAATATGTCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134015.1-443s1c1
Sequence:CCGGGCTTTACCAGAGCAAGGCTTACTCGAGTAAGCCTTGCTCTGGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134015.1-1602s1c1
Sequence:CCGGGCTCCCATGATGACACTATTTCTCGAGAAATAGTGTCATCATGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134015.1-850s1c1
Sequence:CCGGCCGGGACAACTCTATCAAGATCTCGAGATCTTGATAGAGTTGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-2047s21c1
Sequence:CCGGGCGCCTTGGTTTGGTACTAAACTCGAGTTTAGTACCAAACCAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134015.2-1602s21c1
Sequence:CCGGGCTCCCATGATGACACTATTTCTCGAGAAATAGTGTCATCATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-1350s21c1
Sequence:CCGGCCATCCGGTTATGGGATATTGCTCGAGCAATATCCCATAACCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-939s21c1
Sequence:CCGGAGTATGATGAGCGAGTCATTGCTCGAGCAATGACTCGCTCATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134015.2-417s21c1
Sequence:CCGGCCATGTTGCAGCGGGACTTTACTCGAGTAAAGTCCCGCTGCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012300
VALIDATED
FBXW11 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 11
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012300.x-4212s1c1
Sequence:CCGGGTCCAGTAAATTGCTAAGTAACTCGAGTTACTTAGCAATTTACTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-1011s1c1
Sequence:CCGGGTGTCATTGTAACTGGCTCTTCTCGAGAAGAGCCAGTTACAATGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-329s1c1
Sequence:CCGGCCATCAGAAGGAAACTATCAACTCGAGTTGATAGTTTCCTTCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-644s1c1
Sequence:CCGGGAACGAATGGTACGCACTGATCTCGAGATCAGTGCGTACCATTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-1327s1c1
Sequence:CCGGTCGTACTCTCAATGGGCACAACTCGAGTTGTGCCCATTGAGAGTACGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1628s21c1
Sequence:CCGGATCATCAGATAATACCATTAGCTCGAGCTAATGGTATTATCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1709s21c1
Sequence:CCGGCCGATGCATCCGGTTTGATAACTCGAGTTATCAAACCGGATGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012300.2-2339s21c1
Sequence:CCGGAGAAGACTTGGCCTCTAATTTCTCGAGAAATTAGAGGCCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1894s21c1
Sequence:CCGGGCTCCCATGATGACACTATTTCTCGAGAAATAGTGTCATCATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012300.2-1130s21c1
Sequence:CCGGTATCAGTGGCCTACGAGATAACTCGAGTTATCTCGTAGGCCACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012300.2-2144s21c1
Sequence:CCGGACTCTTCAAGTACCGACATTTCTCGAGAAATGTCGGTACTTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1815s21c1
Sequence:CCGGACATTGTGTTTGCGCACATTGCTCGAGCAATGTGCGCAAACACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012300
VALIDATED
FBXW11 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 11
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012300.x-4212s1c1
Sequence:CCGGGTCCAGTAAATTGCTAAGTAACTCGAGTTACTTAGCAATTTACTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-1011s1c1
Sequence:CCGGGTGTCATTGTAACTGGCTCTTCTCGAGAAGAGCCAGTTACAATGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-329s1c1
Sequence:CCGGCCATCAGAAGGAAACTATCAACTCGAGTTGATAGTTTCCTTCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-644s1c1
Sequence:CCGGGAACGAATGGTACGCACTGATCTCGAGATCAGTGCGTACCATTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-1327s1c1
Sequence:CCGGTCGTACTCTCAATGGGCACAACTCGAGTTGTGCCCATTGAGAGTACGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1628s21c1
Sequence:CCGGATCATCAGATAATACCATTAGCTCGAGCTAATGGTATTATCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1709s21c1
Sequence:CCGGCCGATGCATCCGGTTTGATAACTCGAGTTATCAAACCGGATGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012300.2-2339s21c1
Sequence:CCGGAGAAGACTTGGCCTCTAATTTCTCGAGAAATTAGAGGCCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1894s21c1
Sequence:CCGGGCTCCCATGATGACACTATTTCTCGAGAAATAGTGTCATCATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012300.2-1130s21c1
Sequence:CCGGTATCAGTGGCCTACGAGATAACTCGAGTTATCTCGTAGGCCACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012300.2-2144s21c1
Sequence:CCGGACTCTTCAAGTACCGACATTTCTCGAGAAATGTCGGTACTTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1815s21c1
Sequence:CCGGACATTGTGTTTGCGCACATTGCTCGAGCAATGTGCGCAAACACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012300
VALIDATED
FBXW11 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 11
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012300.x-4212s1c1
Sequence:CCGGGTCCAGTAAATTGCTAAGTAACTCGAGTTACTTAGCAATTTACTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-1011s1c1
Sequence:CCGGGTGTCATTGTAACTGGCTCTTCTCGAGAAGAGCCAGTTACAATGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-329s1c1
Sequence:CCGGCCATCAGAAGGAAACTATCAACTCGAGTTGATAGTTTCCTTCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-644s1c1
Sequence:CCGGGAACGAATGGTACGCACTGATCTCGAGATCAGTGCGTACCATTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012300.x-1327s1c1
Sequence:CCGGTCGTACTCTCAATGGGCACAACTCGAGTTGTGCCCATTGAGAGTACGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1628s21c1
Sequence:CCGGATCATCAGATAATACCATTAGCTCGAGCTAATGGTATTATCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1709s21c1
Sequence:CCGGCCGATGCATCCGGTTTGATAACTCGAGTTATCAAACCGGATGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012300.2-2339s21c1
Sequence:CCGGAGAAGACTTGGCCTCTAATTTCTCGAGAAATTAGAGGCCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1894s21c1
Sequence:CCGGGCTCCCATGATGACACTATTTCTCGAGAAATAGTGTCATCATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012300.2-1130s21c1
Sequence:CCGGTATCAGTGGCCTACGAGATAACTCGAGTTATCTCGTAGGCCACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012300.2-2144s21c1
Sequence:CCGGACTCTTCAAGTACCGACATTTCTCGAGAAATGTCGGTACTTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012300.2-1815s21c1
Sequence:CCGGACATTGTGTTTGCGCACATTGCTCGAGCAATGTGCGCAAACACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks