EMAIL THIS PAGE TO A FRIEND

FBXW12

F-box and WD repeat domain containing 12

45 Gene Product Result for
Synonyms: FBW12 FBXO12 FBXO35
UniProtKB ID: Q6X9E4, E9PG36, Q494Y9, Q494Z0
Gene ID:
Human(285231) Summary: Members of the F-box protein family, such as FBXW12, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603034), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Rat(301015) F-box and WD repeat domain containing 12
dog(484779) F-box and WD repeat domain containing 12
cow(528919) F-box and WD repeat domain containing 12
domestic cat(101087138) F-box and WD repeat domain containing 12
sheep(101120280) F-box and WD repeat domain containing 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207102 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376226 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207102 Rosetta Predictions human pricing
XM_001075538 Rosetta Predictions rat pricing
XM_236641 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177529 predicted 501
2 SASI_Hs01_00177530 predicted 1107
3 SASI_Hs01_00177531 predicted 835
4 SASI_Hs01_00177532 predicted 1154
5 SASI_Hs01_00177533 predicted 1251
6 SASI_Hs01_00177534 predicted 646
7 SASI_Hs01_00177535 predicted 1162
8 SASI_Hs01_00177536 predicted 458
9 SASI_Hs01_00177537 predicted 663
10 SASI_Hs01_00177538 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350133 predicted 495
2 SASI_Rn02_00350134 predicted 981
3 SASI_Rn02_00350135 predicted 887
4 SASI_Rn02_00350136 predicted 836
5 SASI_Rn02_00350137 predicted 928
6 SASI_Rn02_00350138 predicted 685
7 SASI_Rn02_00350139 predicted 589
8 SASI_Rn02_00350140 predicted 790
9 SASI_Rn02_00350141 predicted 278
10 SASI_Rn02_00350142 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390249 predicted 493
2 SASI_Rn02_00390250 predicted 981
3 SASI_Rn02_00390251 predicted 888
4 SASI_Rn02_00390252 predicted 834
5 SASI_Rn02_00390253 predicted 931
6 SASI_Rn02_00390254 predicted 677
7 SASI_Rn02_00390255 predicted 590
8 SASI_Rn02_00390256 predicted 791
9 SASI_Rn02_00390257 predicted 280
10 SASI_Rn02_00390258 predicted 571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207102
VALIDATED
FBXW12 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-458s21c1
Sequence:CCGGTAACTAAGAACATCGCATTTGCTCGAGCAAATGCGATGTTCTTAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-1294s21c1
Sequence:CCGGGGCTTCCTGCTGCAACGATTTCTCGAGAAATCGTTGCAGCAGGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-285s21c1
Sequence:CCGGTAGGATTGCAGACAGTGATTACTCGAGTAATCACTGTCTGCAATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-1506s21c1
Sequence:CCGGTAATGCAAGCATAGTACTTAGCTCGAGCTAAGTACTATGCTTGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207102.1-436s1c1
Sequence:CCGGCCGCATAACTTTATCTACAAACTCGAGTTTGTAGATAAAGTTATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-1086s1c1
Sequence:CCGGGTCCCAAAGTAGCACTGGAAACTCGAGTTTCCAGTGCTACTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-1156s1c1
Sequence:CCGGCAAACAGTCATCCAAGCATATCTCGAGATATGCTTGGATGACTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-907s1c1
Sequence:CCGGCCTGACAAGAAATGGGTATTTCTCGAGAAATACCCATTTCTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-667s1c1
Sequence:CCGGGCCATCACTATGGATCGGAAACTCGAGTTTCCGATCCATAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207102
VALIDATED
FBXW12 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-458s21c1
Sequence:CCGGTAACTAAGAACATCGCATTTGCTCGAGCAAATGCGATGTTCTTAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-1294s21c1
Sequence:CCGGGGCTTCCTGCTGCAACGATTTCTCGAGAAATCGTTGCAGCAGGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-285s21c1
Sequence:CCGGTAGGATTGCAGACAGTGATTACTCGAGTAATCACTGTCTGCAATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-1506s21c1
Sequence:CCGGTAATGCAAGCATAGTACTTAGCTCGAGCTAAGTACTATGCTTGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207102.1-436s1c1
Sequence:CCGGCCGCATAACTTTATCTACAAACTCGAGTTTGTAGATAAAGTTATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-1086s1c1
Sequence:CCGGGTCCCAAAGTAGCACTGGAAACTCGAGTTTCCAGTGCTACTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-1156s1c1
Sequence:CCGGCAAACAGTCATCCAAGCATATCTCGAGATATGCTTGGATGACTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-907s1c1
Sequence:CCGGCCTGACAAGAAATGGGTATTTCTCGAGAAATACCCATTTCTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-667s1c1
Sequence:CCGGGCCATCACTATGGATCGGAAACTCGAGTTTCCGATCCATAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207102
VALIDATED
FBXW12 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-458s21c1
Sequence:CCGGTAACTAAGAACATCGCATTTGCTCGAGCAAATGCGATGTTCTTAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-1294s21c1
Sequence:CCGGGGCTTCCTGCTGCAACGATTTCTCGAGAAATCGTTGCAGCAGGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-285s21c1
Sequence:CCGGTAGGATTGCAGACAGTGATTACTCGAGTAATCACTGTCTGCAATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207102.2-1506s21c1
Sequence:CCGGTAATGCAAGCATAGTACTTAGCTCGAGCTAAGTACTATGCTTGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207102.1-436s1c1
Sequence:CCGGCCGCATAACTTTATCTACAAACTCGAGTTTGTAGATAAAGTTATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-1086s1c1
Sequence:CCGGGTCCCAAAGTAGCACTGGAAACTCGAGTTTCCAGTGCTACTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-1156s1c1
Sequence:CCGGCAAACAGTCATCCAAGCATATCTCGAGATATGCTTGGATGACTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-907s1c1
Sequence:CCGGCCTGACAAGAAATGGGTATTTCTCGAGAAATACCCATTTCTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_207102.1-667s1c1
Sequence:CCGGGCCATCACTATGGATCGGAAACTCGAGTTTCCGATCCATAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376226
FBXW12 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 12
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000121955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376226.1-243s1c1
Sequence:CCGGCTTTGATCTAACAACCAAGAACTCGAGTTCTTGGTTGTTAGATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376226
FBXW12 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 12
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000121955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376226.1-243s1c1
Sequence:CCGGCTTTGATCTAACAACCAAGAACTCGAGTTCTTGGTTGTTAGATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376226
FBXW12 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 12
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000121955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376226.1-243s1c1
Sequence:CCGGCTTTGATCTAACAACCAAGAACTCGAGTTCTTGGTTGTTAGATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks