EMAIL THIS PAGE TO A FRIEND

FBXW2

F-box and WD repeat domain containing 2

Synonyms: FBW2 Fwd2 Md6
Gene ID:
Human(26190) Summary: F-box proteins are an expanding family of eukaryotic proteins characterized by an approximately 40 amino acid motif, the F box. Some F-box proteins have been shown to be critical for the ubiquitin-mediated degradation of cellular regulatory proteins. In fact, F-box proteins are one of the four subunits of ubiquitin protein ligases, called SCFs. SCF ligases bring ubiquitin conjugating enzymes to substrates that are specifically recruited by the different F-box proteins. Mammalian F-box proteins are classified into three groups based on the presence of either WD-40 repeats, leucine-rich repeats, or the presence or absence of other protein-protein interacting domains. This gene encodes the second identified member of the F-box gene family and contains multiple WD-40 repeats. [provided by RefSeq, Jul 2008]
Mouse(30050) F-box and WD-40 domain protein 2
Rat(311881) F-box and WD repeat domain containing 2
sheep(101122758) F-box and WD repeat domain containing 2
Domestic Rabbit(100339343) F-box and WD repeat domain containing 2
domestic guinea pig(100723973) F-box and WD repeat domain containing 2
naked mole-rat(101724545) F-box and WD repeat domain containing 2
Zebrafish(553942) F-box and WD repeat domain containing 2
cow(767863) F-box and WD repeat domain containing 2
Horse(100067698) F-box and WD repeat domain containing 2
domestic cat(101086186) F-box and WD repeat domain containing 2
dog(610990) F-box and WD repeat domain containing 2
chicken(417088) F-box and WD repeat domain containing 2
385 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012164 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012164 Rosetta Predictions human pricing
NM_001107835 Rosetta Predictions rat pricing
NM_013890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152813 predicted 1131
2 SASI_Hs02_00343760 predicted 1699
3 SASI_Hs01_00152815 predicted 464
4 SASI_Hs01_00152816 predicted 979
5 SASI_Hs01_00152818 predicted 1237
6 SASI_Hs01_00152819 predicted 1291
7 SASI_Hs01_00152820 predicted 690
8 SASI_Hs02_00343761 predicted 1244
9 SASI_Hs01_00152822 predicted 316
10 SASI_Hs02_00343762 predicted 930
11 SASI_Hs01_00152814 predicted 810
12 SASI_Hs01_00152817 predicted 1174
13 SASI_Hs01_00152821 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232745 predicted 369
2 SASI_Rn02_00232746 predicted 558
3 SASI_Rn02_00232747 predicted 891
4 SASI_Rn02_00232748 predicted 632
5 SASI_Rn02_00232749 predicted 575
6 SASI_Rn02_00232750 predicted 1465
7 SASI_Rn02_00232751 predicted 1060
8 SASI_Rn02_00232752 predicted 1227
9 SASI_Rn02_00232753 predicted 660
10 SASI_Rn02_00232754 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051978 predicted 890
2 SASI_Mm01_00051979 predicted 639
3 SASI_Mm01_00051980 predicted 1193
4 SASI_Mm01_00051981 predicted 1038
5 SASI_Mm01_00051982 predicted 1225
6 SASI_Mm01_00051983 predicted 662
7 SASI_Mm01_00051984 predicted 642
8 SASI_Mm02_00322946 predicted 409
9 SASI_Mm01_00051985 predicted 1600
10 SASI_Mm01_00051986 predicted 271
11 SASI_Mm01_00051977 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012164
VALIDATED
FBXW2 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-1570s1c1
Sequence:CCGGGAACCAAAGTTCTCACCTAATCTCGAGATTAGGTGAGAACTTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-535s1c1
Sequence:CCGGGCCTTTGAAACCTCGTCATTACTCGAGTAATGACGAGGTTTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-1130s1c1
Sequence:CCGGGCAAATACATTGTCTGTAGTTCTCGAGAACTACAGACAATGTATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-691s1c1
Sequence:CCGGGCAGCGGTGAAGTTTGATGAACTCGAGTTCATCAAACTTCACCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-859s1c1
Sequence:CCGGGCAGACTTCACTGTGAAAGTACTCGAGTACTTTCACAGTGAAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-473s21c1
Sequence:CCGGACATGCTGCCTCGTCTCTAAACTCGAGTTTAGAGACGAGGCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-650s21c1
Sequence:CCGGGCCTTTGAAACCTCGTCATTACTCGAGTAATGACGAGGTTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-764s21c1
Sequence:CCGGAGCACAGGGCAGTGCGTTTATCTCGAGATAAACGCACTGCCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-806s21c1
Sequence:CCGGGCAGCGGTGAAGTTTGATGAACTCGAGTTCATCAAACTTCACCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-1714s21c1
Sequence:CCGGTCACGCAGTGCACAATCATTTCTCGAGAAATGATTGTGCACTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012164
VALIDATED
FBXW2 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-1570s1c1
Sequence:CCGGGAACCAAAGTTCTCACCTAATCTCGAGATTAGGTGAGAACTTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-535s1c1
Sequence:CCGGGCCTTTGAAACCTCGTCATTACTCGAGTAATGACGAGGTTTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-1130s1c1
Sequence:CCGGGCAAATACATTGTCTGTAGTTCTCGAGAACTACAGACAATGTATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-691s1c1
Sequence:CCGGGCAGCGGTGAAGTTTGATGAACTCGAGTTCATCAAACTTCACCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-859s1c1
Sequence:CCGGGCAGACTTCACTGTGAAAGTACTCGAGTACTTTCACAGTGAAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-473s21c1
Sequence:CCGGACATGCTGCCTCGTCTCTAAACTCGAGTTTAGAGACGAGGCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-650s21c1
Sequence:CCGGGCCTTTGAAACCTCGTCATTACTCGAGTAATGACGAGGTTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-764s21c1
Sequence:CCGGAGCACAGGGCAGTGCGTTTATCTCGAGATAAACGCACTGCCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-806s21c1
Sequence:CCGGGCAGCGGTGAAGTTTGATGAACTCGAGTTCATCAAACTTCACCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-1714s21c1
Sequence:CCGGTCACGCAGTGCACAATCATTTCTCGAGAAATGATTGTGCACTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012164
VALIDATED
FBXW2 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-1570s1c1
Sequence:CCGGGAACCAAAGTTCTCACCTAATCTCGAGATTAGGTGAGAACTTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-535s1c1
Sequence:CCGGGCCTTTGAAACCTCGTCATTACTCGAGTAATGACGAGGTTTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-1130s1c1
Sequence:CCGGGCAAATACATTGTCTGTAGTTCTCGAGAACTACAGACAATGTATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-691s1c1
Sequence:CCGGGCAGCGGTGAAGTTTGATGAACTCGAGTTCATCAAACTTCACCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012164.2-859s1c1
Sequence:CCGGGCAGACTTCACTGTGAAAGTACTCGAGTACTTTCACAGTGAAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-473s21c1
Sequence:CCGGACATGCTGCCTCGTCTCTAAACTCGAGTTTAGAGACGAGGCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-650s21c1
Sequence:CCGGGCCTTTGAAACCTCGTCATTACTCGAGTAATGACGAGGTTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-764s21c1
Sequence:CCGGAGCACAGGGCAGTGCGTTTATCTCGAGATAAACGCACTGCCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-806s21c1
Sequence:CCGGGCAGCGGTGAAGTTTGATGAACTCGAGTTCATCAAACTTCACCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012164.3-1714s21c1
Sequence:CCGGTCACGCAGTGCACAATCATTTCTCGAGAAATGATTGTGCACTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013890
VALIDATED
FBXW2 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013890.2-1595s1c1
Sequence:CCGGGAACCAAAGTTCTCACCTAAACTCGAGTTTAGGTGAGAACTTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013890.2-1009s1c1
Sequence:CCGGCCTGGAGACTACATCCTCTTACTCGAGTAAGAGGATGTAGTCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013890.2-391s1c1
Sequence:CCGGCTGGTCTCTAAGCAGTGGAATCTCGAGATTCCACTGCTTAGAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013890.2-1473s1c1
Sequence:CCGGCCACAGTATTCACCTGGTGTTCTCGAGAACACCAGGTGAATACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013890.2-569s1c1
Sequence:CCGGCCTCTTCGTTAATTGGACATACTCGAGTATGTCCAATTAACGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-1008s21c1
Sequence:CCGGCCTGGAGACTACATCCTCTTACTCGAGTAAGAGGATGTAGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-390s21c1
Sequence:CCGGCTGGTCTCTAAGCAGTGGAATCTCGAGATTCCACTGCTTAGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-1472s21c1
Sequence:CCGGCCACAGTATTCACCTGGTGTTCTCGAGAACACCAGGTGAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-568s21c1
Sequence:CCGGCCTCTTCGTTAATTGGACATACTCGAGTATGTCCAATTAACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013890.3-1594s21c1
Sequence:CCGGGAACCAAAGTTCTCACCTAAACTCGAGTTTAGGTGAGAACTTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013890
VALIDATED
FBXW2 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013890.2-1595s1c1
Sequence:CCGGGAACCAAAGTTCTCACCTAAACTCGAGTTTAGGTGAGAACTTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013890.2-1009s1c1
Sequence:CCGGCCTGGAGACTACATCCTCTTACTCGAGTAAGAGGATGTAGTCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013890.2-391s1c1
Sequence:CCGGCTGGTCTCTAAGCAGTGGAATCTCGAGATTCCACTGCTTAGAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013890.2-1473s1c1
Sequence:CCGGCCACAGTATTCACCTGGTGTTCTCGAGAACACCAGGTGAATACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013890.2-569s1c1
Sequence:CCGGCCTCTTCGTTAATTGGACATACTCGAGTATGTCCAATTAACGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-1008s21c1
Sequence:CCGGCCTGGAGACTACATCCTCTTACTCGAGTAAGAGGATGTAGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-390s21c1
Sequence:CCGGCTGGTCTCTAAGCAGTGGAATCTCGAGATTCCACTGCTTAGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-1472s21c1
Sequence:CCGGCCACAGTATTCACCTGGTGTTCTCGAGAACACCAGGTGAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-568s21c1
Sequence:CCGGCCTCTTCGTTAATTGGACATACTCGAGTATGTCCAATTAACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013890.3-1594s21c1
Sequence:CCGGGAACCAAAGTTCTCACCTAAACTCGAGTTTAGGTGAGAACTTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013890
VALIDATED
FBXW2 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013890.2-1595s1c1
Sequence:CCGGGAACCAAAGTTCTCACCTAAACTCGAGTTTAGGTGAGAACTTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013890.2-1009s1c1
Sequence:CCGGCCTGGAGACTACATCCTCTTACTCGAGTAAGAGGATGTAGTCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013890.2-391s1c1
Sequence:CCGGCTGGTCTCTAAGCAGTGGAATCTCGAGATTCCACTGCTTAGAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013890.2-1473s1c1
Sequence:CCGGCCACAGTATTCACCTGGTGTTCTCGAGAACACCAGGTGAATACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013890.2-569s1c1
Sequence:CCGGCCTCTTCGTTAATTGGACATACTCGAGTATGTCCAATTAACGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-1008s21c1
Sequence:CCGGCCTGGAGACTACATCCTCTTACTCGAGTAAGAGGATGTAGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-390s21c1
Sequence:CCGGCTGGTCTCTAAGCAGTGGAATCTCGAGATTCCACTGCTTAGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-1472s21c1
Sequence:CCGGCCACAGTATTCACCTGGTGTTCTCGAGAACACCAGGTGAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013890.3-568s21c1
Sequence:CCGGCCTCTTCGTTAATTGGACATACTCGAGTATGTCCAATTAACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013890.3-1594s21c1
Sequence:CCGGGAACCAAAGTTCTCACCTAAACTCGAGTTTAGGTGAGAACTTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks