EMAIL THIS PAGE TO A FRIEND

FBXW4

F-box and WD repeat domain containing 4

70 Gene Product Result for
Synonyms: DAC FBW4 FBWD4 SHFM3 SHSF3
UniProtKB ID: P57775, Q5SVS1, Q96IM6
Gene ID:
Human(6468) Summary: This gene is a member of the F-box/WD-40 gene family, which recruit specific target proteins through their WD-40 protein-protein binding domains for ubiquitin mediated degradation. In mouse, a highly similar protein is thought to be responsible for maintaining the apical ectodermal ridge of developing limb buds; disruption of the mouse gene results in the absence of central digits, underdeveloped or absent metacarpal/metatarsal bones and syndactyly. This phenotype is remarkably similar to split hand-split foot malformation in humans, a clinically heterogeneous condition with a variety of modes of transmission. An autosomal recessive form has been mapped to the chromosomal region where this gene is located, and complex rearrangements involving duplications of this gene and others have been associated with the condition. A pseudogene of this locus has been mapped to one of the introns of the BCR gene on chromosome 22. [provided by RefSeq, Jul 2008]
Mouse(30838) F-box and WD-40 domain protein 4
Rat(309444) F-box and WD repeat domain containing 4
sheep(101113450) F-box and WD repeat domain containing 4
naked mole-rat(101698837) F-box and WD repeat domain containing 4
domestic guinea pig(100721914) F-box and WD repeat domain containing 4
Zebrafish(58035) F-box and WD-40 domain protein 4
chicken(770459) F-box and WD repeat domain containing 4
dog(486852) F-box and WD repeat domain containing 4
cow(513977) F-box and WD repeat domain containing 4
domestic cat(101084392) F-box and WD repeat domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022039 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104611 MISSION® esiRNA esiRNA human FBXW4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022039 Rosetta Predictions human pricing
NM_001107600 Rosetta Predictions rat pricing
NM_013907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240386 predicted 941
2 SASI_Hs01_00240387 predicted 1090
3 SASI_Hs01_00240388 predicted 1740
4 SASI_Hs01_00240389 predicted 1493
5 SASI_Hs01_00240390 predicted 1082
6 SASI_Hs01_00240391 predicted 632
7 SASI_Hs01_00240392 predicted 951
8 SASI_Hs01_00240393 predicted 933
9 SASI_Hs01_00240395 predicted 812
10 SASI_Hs02_00355385 predicted 734
11 SASI_Hs01_00240394 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230435 predicted 1154
2 SASI_Rn02_00230436 predicted 487
3 SASI_Rn02_00230437 predicted 543
4 SASI_Rn02_00230438 predicted 741
5 SASI_Rn02_00230439 predicted 1299
6 SASI_Rn02_00230440 predicted 1344
7 SASI_Rn02_00230441 predicted 1110
8 SASI_Rn02_00230442 predicted 764
9 SASI_Rn02_00230443 predicted 499
10 SASI_Rn02_00230444 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039648 predicted 1309
2 SASI_Mm01_00039649 predicted 1156
3 SASI_Mm01_00039650 predicted 1173
4 SASI_Mm01_00039651 predicted 768
5 SASI_Mm01_00039652 predicted 901
6 SASI_Mm01_00039653 predicted 1350
7 SASI_Mm02_00322993 predicted 900
8 SASI_Mm01_00039654 predicted 703
9 SASI_Mm01_00039655 predicted 544
10 SASI_Mm01_00039656 predicted 999
11 SASI_Mm01_00039657 predicted 1342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022039
VALIDATED
FBXW4 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022039.3-715s21c1
Sequence:CCGGGATGCAGCTAGAGGATGATTCCTCGAGGAATCATCCTCTAGCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022039.3-855s21c1
Sequence:CCGGTGCTGGCCAACTCGCATATTGCTCGAGCAATATGCGAGTTGGCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022039.3-897s21c1
Sequence:CCGGAGATTGGCATTCATAAGATTCCTCGAGGAATCTTATGAATGCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022039.x-1040s1c1
Sequence:CCGGGCCTACCAGTTCCGTCCAGATCTCGAGATCTGGACGGAACTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022039.x-1106s1c1
Sequence:CCGGGATGAGGACGTTTGCCACTTTCTCGAGAAAGTGGCAAACGTCCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022039.x-2080s1c1
Sequence:CCGGGCTGCTTTAGAGTGCGGCTGACTCGAGTCAGCCGCACTCTAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022039.x-1790s1c1
Sequence:CCGGCTCACCACCAAGCATCTCTATCTCGAGATAGAGATGCTTGGTGGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022039.x-961s1c1
Sequence:CCGGGAAGTGGAGATGCAGTCAGATCTCGAGATCTGACTGCATCTCCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022039
VALIDATED
FBXW4 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022039.3-715s21c1
Sequence:CCGGGATGCAGCTAGAGGATGATTCCTCGAGGAATCATCCTCTAGCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022039.3-855s21c1
Sequence:CCGGTGCTGGCCAACTCGCATATTGCTCGAGCAATATGCGAGTTGGCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022039.3-897s21c1
Sequence:CCGGAGATTGGCATTCATAAGATTCCTCGAGGAATCTTATGAATGCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022039.x-1040s1c1
Sequence:CCGGGCCTACCAGTTCCGTCCAGATCTCGAGATCTGGACGGAACTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022039.x-1106s1c1
Sequence:CCGGGATGAGGACGTTTGCCACTTTCTCGAGAAAGTGGCAAACGTCCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022039.x-2080s1c1
Sequence:CCGGGCTGCTTTAGAGTGCGGCTGACTCGAGTCAGCCGCACTCTAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022039.x-1790s1c1
Sequence:CCGGCTCACCACCAAGCATCTCTATCTCGAGATAGAGATGCTTGGTGGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022039.x-961s1c1
Sequence:CCGGGAAGTGGAGATGCAGTCAGATCTCGAGATCTGACTGCATCTCCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022039
VALIDATED
FBXW4 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022039.3-715s21c1
Sequence:CCGGGATGCAGCTAGAGGATGATTCCTCGAGGAATCATCCTCTAGCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022039.3-855s21c1
Sequence:CCGGTGCTGGCCAACTCGCATATTGCTCGAGCAATATGCGAGTTGGCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022039.3-897s21c1
Sequence:CCGGAGATTGGCATTCATAAGATTCCTCGAGGAATCTTATGAATGCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022039.x-1040s1c1
Sequence:CCGGGCCTACCAGTTCCGTCCAGATCTCGAGATCTGGACGGAACTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022039.x-1106s1c1
Sequence:CCGGGATGAGGACGTTTGCCACTTTCTCGAGAAAGTGGCAAACGTCCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022039.x-2080s1c1
Sequence:CCGGGCTGCTTTAGAGTGCGGCTGACTCGAGTCAGCCGCACTCTAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022039.x-1790s1c1
Sequence:CCGGCTCACCACCAAGCATCTCTATCTCGAGATAGAGATGCTTGGTGGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022039.x-961s1c1
Sequence:CCGGGAAGTGGAGATGCAGTCAGATCTCGAGATCTGACTGCATCTCCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013907
VALIDATED
FBXW4 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013907.2-1160s21c1
Sequence:CCGGGCCTCATGACAGTACCTTCTACTCGAGTAGAAGGTACTGTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013907.2-959s21c1
Sequence:CCGGGCACTTCTCACCTCTGAGAATCTCGAGATTCTCAGAGGTGAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013907.2-1584s21c1
Sequence:CCGGCTGTGCTCTTAGGAGAATGTACTCGAGTACATTCTCCTAAGAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013907.2-550s21c1
Sequence:CCGGTGTACCTATCACAGGCTAATTCTCGAGAATTAGCCTGTGATAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-550s1c1
Sequence:CCGGTGTACCTATCACAGGCTAATTCTCGAGAATTAGCCTGTGATAGGTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-1584s1c1
Sequence:CCGGCTGTGCTCTTAGGAGAATGTACTCGAGTACATTCTCCTAAGAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-959s1c1
Sequence:CCGGGCACTTCTCACCTCTGAGAATCTCGAGATTCTCAGAGGTGAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-1160s1c1
Sequence:CCGGGCCTCATGACAGTACCTTCTACTCGAGTAGAAGGTACTGTCATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013907
VALIDATED
FBXW4 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013907.2-1160s21c1
Sequence:CCGGGCCTCATGACAGTACCTTCTACTCGAGTAGAAGGTACTGTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013907.2-959s21c1
Sequence:CCGGGCACTTCTCACCTCTGAGAATCTCGAGATTCTCAGAGGTGAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013907.2-1584s21c1
Sequence:CCGGCTGTGCTCTTAGGAGAATGTACTCGAGTACATTCTCCTAAGAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013907.2-550s21c1
Sequence:CCGGTGTACCTATCACAGGCTAATTCTCGAGAATTAGCCTGTGATAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-550s1c1
Sequence:CCGGTGTACCTATCACAGGCTAATTCTCGAGAATTAGCCTGTGATAGGTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-1584s1c1
Sequence:CCGGCTGTGCTCTTAGGAGAATGTACTCGAGTACATTCTCCTAAGAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-959s1c1
Sequence:CCGGGCACTTCTCACCTCTGAGAATCTCGAGATTCTCAGAGGTGAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-1160s1c1
Sequence:CCGGGCCTCATGACAGTACCTTCTACTCGAGTAGAAGGTACTGTCATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013907
VALIDATED
FBXW4 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013907.2-1160s21c1
Sequence:CCGGGCCTCATGACAGTACCTTCTACTCGAGTAGAAGGTACTGTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013907.2-959s21c1
Sequence:CCGGGCACTTCTCACCTCTGAGAATCTCGAGATTCTCAGAGGTGAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013907.2-1584s21c1
Sequence:CCGGCTGTGCTCTTAGGAGAATGTACTCGAGTACATTCTCCTAAGAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013907.2-550s21c1
Sequence:CCGGTGTACCTATCACAGGCTAATTCTCGAGAATTAGCCTGTGATAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-550s1c1
Sequence:CCGGTGTACCTATCACAGGCTAATTCTCGAGAATTAGCCTGTGATAGGTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-1584s1c1
Sequence:CCGGCTGTGCTCTTAGGAGAATGTACTCGAGTACATTCTCCTAAGAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-959s1c1
Sequence:CCGGGCACTTCTCACCTCTGAGAATCTCGAGATTCTCAGAGGTGAGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013907.1-1160s1c1
Sequence:CCGGGCCTCATGACAGTACCTTCTACTCGAGTAGAAGGTACTGTCATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks