EMAIL THIS PAGE TO A FRIEND

FBXW4P1

F-box and WD repeat domain containing 4 pseudogene 1

3 Gene Product Result for
Synonyms: FBW3 FBXW3 SHFM3P1
Species: Human FBXW4P1(26226)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1403183 Monoclonal Anti-SHFM3P1 antibody produced in mouse clone 3F1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012165 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012165
FBXW4P1 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 4 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-897s1c1
Sequence:CCGGTGGGAAGATTGGCCTTGGTAACTCGAGTTACCAAGGCCAATCTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-1086s1c1
Sequence:CCGGCCAAATCTGGTCTGTTGCTATCTCGAGATAGCAACAGACCAGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-1414s1c1
Sequence:CCGGTCCTCCTTCTATAGCGTTGTACTCGAGTACAACGCTATAGAAGGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-989s1c1
Sequence:CCGGGCATCATATCATTTGGCTCCACTCGAGTGGAGCCAAATGATATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-1095s1c1
Sequence:CCGGGTCTGTTGCTATCAGGCCATTCTCGAGAATGGCCTGATAGCAACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012165
FBXW4P1 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 4 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-897s1c1
Sequence:CCGGTGGGAAGATTGGCCTTGGTAACTCGAGTTACCAAGGCCAATCTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-1086s1c1
Sequence:CCGGCCAAATCTGGTCTGTTGCTATCTCGAGATAGCAACAGACCAGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-1414s1c1
Sequence:CCGGTCCTCCTTCTATAGCGTTGTACTCGAGTACAACGCTATAGAAGGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-989s1c1
Sequence:CCGGGCATCATATCATTTGGCTCCACTCGAGTGGAGCCAAATGATATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-1095s1c1
Sequence:CCGGGTCTGTTGCTATCAGGCCATTCTCGAGAATGGCCTGATAGCAACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012165
FBXW4P1 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 4 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-897s1c1
Sequence:CCGGTGGGAAGATTGGCCTTGGTAACTCGAGTTACCAAGGCCAATCTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-1086s1c1
Sequence:CCGGCCAAATCTGGTCTGTTGCTATCTCGAGATAGCAACAGACCAGATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-1414s1c1
Sequence:CCGGTCCTCCTTCTATAGCGTTGTACTCGAGTACAACGCTATAGAAGGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-989s1c1
Sequence:CCGGGCATCATATCATTTGGCTCCACTCGAGTGGAGCCAAATGATATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012165.1-1095s1c1
Sequence:CCGGGTCTGTTGCTATCAGGCCATTCTCGAGAATGGCCTGATAGCAACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks