EMAIL THIS PAGE TO A FRIEND

FBXW5

F-box and WD repeat domain containing 5

55 Gene Product Result for
Synonyms: Fbw5
Gene ID:
Human(54461) Summary: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented. [provided by RefSeq, Jul 2008]
Mouse(30839) F-box and WD-40 domain protein 5
Rat(362081) F-box and WD repeat domain containing 5
Zebrafish(406611) F-box and WD-40 domain protein 5
chicken(417289) F-box and WD repeat domain containing 5
dog(491243) F-box and WD repeat domain containing 5
domestic cat(101096616) F-box and WD repeat domain containing 5
Horse(100067988) F-box and WD repeat domain containing 5
cow(517357) F-box and WD repeat domain containing 5
domestic guinea pig(100732858) F-box and WD repeat domain containing 5
naked mole-rat(101701263) F-box and WD repeat domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018998 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094901 MISSION® esiRNA esiRNA human FBXW5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018998 Rosetta Predictions human pricing
NM_001025730 Rosetta Predictions rat pricing
NM_013908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077688 predicted 1248
2 SASI_Hs01_00077690 predicted 843
3 SASI_Hs02_00352507 predicted 416
4 SASI_Hs01_00077692 predicted 553
5 SASI_Hs01_00077693 predicted 1054
6 SASI_Hs01_00077694 predicted 1039
7 SASI_Hs01_00077696 predicted 697
8 SASI_Hs01_00077697 predicted 347
9 SASI_Hs02_00352508 predicted 1230
10 SASI_Hs02_00352509 predicted 533
11 SASI_Hs01_00077689 predicted 724
12 SASI_Hs01_00077691 predicted 1193
13 SASI_Hs01_00077695 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076943 predicted 1848
2 SASI_Rn02_00203362 predicted 1729
3 SASI_Rn01_00076944 predicted 1366
4 SASI_Rn01_00076945 predicted 523
5 SASI_Rn02_00203363 predicted 1177
6 SASI_Rn01_00076949 predicted 1540
7 SASI_Rn01_00076950 predicted 678
8 SASI_Rn01_00076951 predicted 830
9 SASI_Rn01_00076952 predicted 525
10 SASI_Rn02_00203364 predicted 1915
11 SASI_Rn01_00076946 predicted 815
12 SASI_Rn01_00076947 predicted 1918
13 SASI_Rn01_00076948 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038832 predicted 694
2 SASI_Mm01_00038833 predicted 1370
3 SASI_Mm01_00038834 predicted 518
4 SASI_Mm01_00038835 predicted 443
5 SASI_Mm01_00038836 predicted 1171
6 SASI_Mm02_00322994 predicted 254
7 SASI_Mm01_00038837 predicted 1020
8 SASI_Mm01_00038838 predicted 1457
9 SASI_Mm01_00038839 predicted 561
10 SASI_Mm02_00322995 predicted 645
11 SASI_Mm01_00038840 predicted 835
12 SASI_Mm01_00038841 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013908
VALIDATED
FBXW5 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013908.1-1818s1c1
Sequence:CCGGGCTTCAGTGATTTGAGCCATTCTCGAGAATGGCTCAAATCACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013908.1-801s1c1
Sequence:CCGGGCGGCTCTTTAAGATCCAGAACTCGAGTTCTGGATCTTAAAGAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013908.1-1017s1c1
Sequence:CCGGGCGTGTGTTTGATAGCGTCTTCTCGAGAAGACGCTATCAAACACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013908.1-1512s1c1
Sequence:CCGGCGAGTGCTTCTTCATCTTCTTCTCGAGAAGAAGATGAAGAAGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013908.1-213s1c1
Sequence:CCGGCCGGGATGAGTTCTTATGGAACTCGAGTTCCATAAGAACTCATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013908.4-1551s21c1
Sequence:CCGGCGAGTGCTTCTTCATCTTCTTCTCGAGAAGAAGATGAAGAAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013908.4-1857s21c1
Sequence:CCGGGCTTCAGTGATTTGAGCCATTCTCGAGAATGGCTCAAATCACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013908.4-1056s21c1
Sequence:CCGGGCGTGTGTTTGATAGCGTCTTCTCGAGAAGACGCTATCAAACACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013908.4-840s21c1
Sequence:CCGGGCGGCTCTTTAAGATCCAGAACTCGAGTTCTGGATCTTAAAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013908
VALIDATED
FBXW5 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013908.1-1818s1c1
Sequence:CCGGGCTTCAGTGATTTGAGCCATTCTCGAGAATGGCTCAAATCACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013908.1-801s1c1
Sequence:CCGGGCGGCTCTTTAAGATCCAGAACTCGAGTTCTGGATCTTAAAGAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013908.1-1017s1c1
Sequence:CCGGGCGTGTGTTTGATAGCGTCTTCTCGAGAAGACGCTATCAAACACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013908.1-1512s1c1
Sequence:CCGGCGAGTGCTTCTTCATCTTCTTCTCGAGAAGAAGATGAAGAAGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013908.1-213s1c1
Sequence:CCGGCCGGGATGAGTTCTTATGGAACTCGAGTTCCATAAGAACTCATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013908.4-1551s21c1
Sequence:CCGGCGAGTGCTTCTTCATCTTCTTCTCGAGAAGAAGATGAAGAAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013908.4-1857s21c1
Sequence:CCGGGCTTCAGTGATTTGAGCCATTCTCGAGAATGGCTCAAATCACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013908.4-1056s21c1
Sequence:CCGGGCGTGTGTTTGATAGCGTCTTCTCGAGAAGACGCTATCAAACACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013908.4-840s21c1
Sequence:CCGGGCGGCTCTTTAAGATCCAGAACTCGAGTTCTGGATCTTAAAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013908
VALIDATED
FBXW5 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013908.1-1818s1c1
Sequence:CCGGGCTTCAGTGATTTGAGCCATTCTCGAGAATGGCTCAAATCACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013908.1-801s1c1
Sequence:CCGGGCGGCTCTTTAAGATCCAGAACTCGAGTTCTGGATCTTAAAGAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013908.1-1017s1c1
Sequence:CCGGGCGTGTGTTTGATAGCGTCTTCTCGAGAAGACGCTATCAAACACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013908.1-1512s1c1
Sequence:CCGGCGAGTGCTTCTTCATCTTCTTCTCGAGAAGAAGATGAAGAAGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013908.1-213s1c1
Sequence:CCGGCCGGGATGAGTTCTTATGGAACTCGAGTTCCATAAGAACTCATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013908.4-1551s21c1
Sequence:CCGGCGAGTGCTTCTTCATCTTCTTCTCGAGAAGAAGATGAAGAAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013908.4-1857s21c1
Sequence:CCGGGCTTCAGTGATTTGAGCCATTCTCGAGAATGGCTCAAATCACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013908.4-1056s21c1
Sequence:CCGGGCGTGTGTTTGATAGCGTCTTCTCGAGAAGACGCTATCAAACACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013908.4-840s21c1
Sequence:CCGGGCGGCTCTTTAAGATCCAGAACTCGAGTTCTGGATCTTAAAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018998
VALIDATED
FBXW5 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018998.x-829s1c1
Sequence:CCGGTGTGGAGTCAGAGAACGTCAACTCGAGTTGACGTTCTCTGACTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-714s1c1
Sequence:CCGGCCTATGACGTGTTTGGCTGTTCTCGAGAACAGCCAAACACGTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-700s1c1
Sequence:CCGGCGTGCGGAACAAGCCCTATGACTCGAGTCATAGGGCTTGTTCCGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-1558s1c1
Sequence:CCGGCGACGAGTGCTTCTTCATCTTCTCGAGAAGATGAAGAAGCACTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-1345s1c1
Sequence:CCGGCATAGACATACACGGACACATCTCGAGATGTGTCCGTGTATGTCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018998.2-1989s21c1
Sequence:CCGGGCTCACACACAAACCTGCTCACTCGAGTGAGCAGGTTTGTGTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018998.2-1941s21c1
Sequence:CCGGCTTATAGCAGTTACGCCTTAGCTCGAGCTAAGGCGTAACTGCTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018998.2-768s21c1
Sequence:CCGGTGCACCGCATCGGAGATATCACTCGAGTGATATCTCCGATGCGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018998
VALIDATED
FBXW5 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018998.x-829s1c1
Sequence:CCGGTGTGGAGTCAGAGAACGTCAACTCGAGTTGACGTTCTCTGACTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-714s1c1
Sequence:CCGGCCTATGACGTGTTTGGCTGTTCTCGAGAACAGCCAAACACGTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-700s1c1
Sequence:CCGGCGTGCGGAACAAGCCCTATGACTCGAGTCATAGGGCTTGTTCCGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-1558s1c1
Sequence:CCGGCGACGAGTGCTTCTTCATCTTCTCGAGAAGATGAAGAAGCACTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-1345s1c1
Sequence:CCGGCATAGACATACACGGACACATCTCGAGATGTGTCCGTGTATGTCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018998.2-1989s21c1
Sequence:CCGGGCTCACACACAAACCTGCTCACTCGAGTGAGCAGGTTTGTGTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018998.2-1941s21c1
Sequence:CCGGCTTATAGCAGTTACGCCTTAGCTCGAGCTAAGGCGTAACTGCTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018998.2-768s21c1
Sequence:CCGGTGCACCGCATCGGAGATATCACTCGAGTGATATCTCCGATGCGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018998
VALIDATED
FBXW5 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018998.x-829s1c1
Sequence:CCGGTGTGGAGTCAGAGAACGTCAACTCGAGTTGACGTTCTCTGACTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-714s1c1
Sequence:CCGGCCTATGACGTGTTTGGCTGTTCTCGAGAACAGCCAAACACGTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-700s1c1
Sequence:CCGGCGTGCGGAACAAGCCCTATGACTCGAGTCATAGGGCTTGTTCCGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-1558s1c1
Sequence:CCGGCGACGAGTGCTTCTTCATCTTCTCGAGAAGATGAAGAAGCACTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018998.x-1345s1c1
Sequence:CCGGCATAGACATACACGGACACATCTCGAGATGTGTCCGTGTATGTCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018998.2-1989s21c1
Sequence:CCGGGCTCACACACAAACCTGCTCACTCGAGTGAGCAGGTTTGTGTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018998.2-1941s21c1
Sequence:CCGGCTTATAGCAGTTACGCCTTAGCTCGAGCTAAGGCGTAACTGCTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018998.2-768s21c1
Sequence:CCGGTGCACCGCATCGGAGATATCACTCGAGTGATATCTCCGATGCGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks