EMAIL THIS PAGE TO A FRIEND

FBXW7

F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase

213 Gene Product Result for
Synonyms: AGO CDC4 FBW6 FBW7 FBX30 FBXO30 FBXW6 SEL-10 SEL10 hAgo hCdc4
Gene ID:
Human(55294) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
Mouse(50754) F-box and WD-40 domain protein 7
Rat(100360914) F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
sheep(101104688) F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
naked mole-rat(101717987) F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
domestic guinea pig(100734383) F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
Zebrafish(564991) F-box and WD repeat domain containing 7
chicken(422481) F-box and WD repeat domain containing 7
dog(475465) F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
Horse(100062294) F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
cow(540932) F-box and WD repeat domain containing 7
domestic cat(101096146) F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108606 Anti-FBXW7 affinity isolated antibody human, human, mouse, rat, bovine, rabbit, guinea pig, canine, horse
immunohistochemistry, western blot pricing
SAB1407650 Anti-FBXW7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV47419 Anti-FBXW7 antibody produced in rabbit affinity isolated antibody mouse, rabbit, guinea pig, horse, canine, bovine, human
western blot pricing
SAB2105360 Anti-FBXW7 antibody produced in rabbit affinity isolated antibody horse, rabbit, mouse, guinea pig
western blot pricing
SAB1411047 Anti-FBXW7 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5500104 Anti-FBXW7 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP237, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
WH0055294M2 Monoclonal Anti-FBXW7 antibody produced in mouse clone 3D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405149 Monoclonal Anti-FBXW7, (C-terminal) antibody produced in mouse clone 1C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
F2055 Monoclonal Anti-hFBXW7 antibody produced in mouse clone FB407, purified immunoglobulin human, rat, mouse
ELISA, immunocytochemistry, western blot pricing
F1930 Monoclonal Anti-hFBXW7γ antibody produced in mouse ~2 mg/mL, clone FB343, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018315 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013415 Rosetta Predictions human pricing
NM_018315 Rosetta Predictions human pricing
NM_033632 Rosetta Predictions human pricing
NM_080428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099117 predicted 1170
2 SASI_Hs01_00099119 predicted 1528
3 SASI_Hs01_00099120 predicted 1087
4 SASI_Hs01_00099121 predicted 937
5 SASI_Hs01_00099122 predicted 1192
6 SASI_Hs01_00099123 predicted 1183
7 SASI_Hs02_00306363 predicted 647
8 SASI_Hs02_00306364 predicted 859
9 SASI_Hs01_00099124 predicted 996
10 SASI_Hs02_00306365 predicted 1704
11 SASI_Hs01_00099116 predicted 1443
12 SASI_Hs01_00099118 predicted 1215
13 SASI_Hs01_00099125 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185229 predicted 1337
2 SASI_Hs01_00185231 predicted 1695
3 SASI_Hs01_00185232 predicted 1250
4 SASI_Hs01_00185233 predicted 1101
5 SASI_Hs01_00185234 predicted 1356
6 SASI_Hs01_00185235 predicted 1344
7 SASI_Hs02_00351735 predicted 808
8 SASI_Hs02_00351736 predicted 1023
9 SASI_Hs01_00185236 predicted 1161
10 SASI_Hs02_00351737 predicted 1870
11 SASI_Hs01_00185228 predicted 1477
12 SASI_Hs01_00185230 predicted 1254
13 SASI_Hs01_00185237 predicted 1751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147263 predicted 1496
2 SASI_Hs01_00147265 predicted 1852
3 SASI_Hs01_00147266 predicted 1415
4 SASI_Hs01_00147267 predicted 1263
5 SASI_Hs01_00147268 predicted 1520
6 SASI_Hs01_00147269 predicted 1511
7 SASI_Hs02_00361445 predicted 968
8 SASI_Hs02_00361446 predicted 1183
9 SASI_Hs01_00147270 predicted 1329
10 SASI_Hs02_00361447 predicted 2028
11 SASI_Hs01_00147262 predicted 1771
12 SASI_Hs01_00147264 predicted 1544
13 SASI_Hs01_00147271 predicted 2047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128866 predicted 1527
2 SASI_Mm01_00128867 predicted 1635
3 SASI_Mm01_00128868 predicted 1300
4 SASI_Mm01_00128869 predicted 1316
5 SASI_Mm02_00338086 predicted 1397
6 SASI_Mm01_00128871 predicted 1467
7 SASI_Mm01_00128872 predicted 1653
8 SASI_Mm01_00128873 predicted 1037
9 SASI_Mm01_00128874 predicted 666
10 SASI_Mm01_00128875 predicted 1380
11 SASI_Mm01_00128870 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080428
VALIDATED
FBXW7 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1470s21c1
Sequence:CCGGTGTTAGTGGAGCTTATGATTTCTCGAGAAATCATAAGCTCCACTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-975s21c1
Sequence:CCGGCCCATGGAAGAGTGCGTATATCTCGAGATATACGCACTCTTCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1897s21c1
Sequence:CCGGATCCGAAACCTCGTCACATTGCTCGAGCAATGTGACGAGGTTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1373s21c1
Sequence:CCGGCTCTCAGGGTTTGGGATATTGCTCGAGCAATATCCCAAACCCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1000s21c1
Sequence:CCGGCAGCACAGAATTGATACAAACCTCGAGGTTTGTATCAATTCTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080428.2-391s21c1
Sequence:CCGGATGGGTTTCTACGGCACATTACTCGAGTAATGTGCCGTAGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1822s21c1
Sequence:CCGGTTCAACAAGAACTTCGTAATTCTCGAGAATTACGAAGTTCTTGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1309s21c1
Sequence:CCGGACTTCTACTGTACGGTGTATGCTCGAGCATACACCGTACAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-1668s1c1
Sequence:CCGGCCAGTCATTAACGAGTGGAATCTCGAGATTCCACTCGTTAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-1401s1c1
Sequence:CCGGCCAGTGTTTACACGTCCTGATCTCGAGATCAGGACGTGTAAACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-595s1c1
Sequence:CCGGCGGAGGATTACATCTGTCCAACTCGAGTTGGACAGATGTAATCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-278s1c1
Sequence:CCGGCCACGTTAGAATCTGTGACATCTCGAGATGTCACAGATTCTAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-1105s1c1
Sequence:CCGGCGCATAGTTAGTGGTTCTGATCTCGAGATCAGAACCACTAACTATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080428
VALIDATED
FBXW7 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1470s21c1
Sequence:CCGGTGTTAGTGGAGCTTATGATTTCTCGAGAAATCATAAGCTCCACTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-975s21c1
Sequence:CCGGCCCATGGAAGAGTGCGTATATCTCGAGATATACGCACTCTTCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1897s21c1
Sequence:CCGGATCCGAAACCTCGTCACATTGCTCGAGCAATGTGACGAGGTTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1373s21c1
Sequence:CCGGCTCTCAGGGTTTGGGATATTGCTCGAGCAATATCCCAAACCCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1000s21c1
Sequence:CCGGCAGCACAGAATTGATACAAACCTCGAGGTTTGTATCAATTCTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080428.2-391s21c1
Sequence:CCGGATGGGTTTCTACGGCACATTACTCGAGTAATGTGCCGTAGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1822s21c1
Sequence:CCGGTTCAACAAGAACTTCGTAATTCTCGAGAATTACGAAGTTCTTGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1309s21c1
Sequence:CCGGACTTCTACTGTACGGTGTATGCTCGAGCATACACCGTACAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-1668s1c1
Sequence:CCGGCCAGTCATTAACGAGTGGAATCTCGAGATTCCACTCGTTAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-1401s1c1
Sequence:CCGGCCAGTGTTTACACGTCCTGATCTCGAGATCAGGACGTGTAAACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-595s1c1
Sequence:CCGGCGGAGGATTACATCTGTCCAACTCGAGTTGGACAGATGTAATCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-278s1c1
Sequence:CCGGCCACGTTAGAATCTGTGACATCTCGAGATGTCACAGATTCTAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-1105s1c1
Sequence:CCGGCGCATAGTTAGTGGTTCTGATCTCGAGATCAGAACCACTAACTATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080428
VALIDATED
FBXW7 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1470s21c1
Sequence:CCGGTGTTAGTGGAGCTTATGATTTCTCGAGAAATCATAAGCTCCACTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-975s21c1
Sequence:CCGGCCCATGGAAGAGTGCGTATATCTCGAGATATACGCACTCTTCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1897s21c1
Sequence:CCGGATCCGAAACCTCGTCACATTGCTCGAGCAATGTGACGAGGTTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1373s21c1
Sequence:CCGGCTCTCAGGGTTTGGGATATTGCTCGAGCAATATCCCAAACCCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1000s21c1
Sequence:CCGGCAGCACAGAATTGATACAAACCTCGAGGTTTGTATCAATTCTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080428.2-391s21c1
Sequence:CCGGATGGGTTTCTACGGCACATTACTCGAGTAATGTGCCGTAGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1822s21c1
Sequence:CCGGTTCAACAAGAACTTCGTAATTCTCGAGAATTACGAAGTTCTTGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080428.2-1309s21c1
Sequence:CCGGACTTCTACTGTACGGTGTATGCTCGAGCATACACCGTACAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-1668s1c1
Sequence:CCGGCCAGTCATTAACGAGTGGAATCTCGAGATTCCACTCGTTAATGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-1401s1c1
Sequence:CCGGCCAGTGTTTACACGTCCTGATCTCGAGATCAGGACGTGTAAACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-595s1c1
Sequence:CCGGCGGAGGATTACATCTGTCCAACTCGAGTTGGACAGATGTAATCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-278s1c1
Sequence:CCGGCCACGTTAGAATCTGTGACATCTCGAGATGTCACAGATTCTAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080428.2-1105s1c1
Sequence:CCGGCGCATAGTTAGTGGTTCTGATCTCGAGATCAGAACCACTAACTATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018315
FBXW7 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-451s21c1
Sequence:CCGGATGGGTTTCTACGGCACATTACTCGAGTAATGTGCCGTAGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018315.4-2135s21c1
Sequence:CCGGCCAATTGTGTAGACGATATACCTCGAGGTATATCGTCTACACAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-325s21c1
Sequence:CCGGTGCCTGAGCATGTCCACATTACTCGAGTAATGTGGACATGCTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018315.4-2507s21c1
Sequence:CCGGCTAGAAAGGAACTGCAATAATCTCGAGATTATTGCAGTTCCTTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-812s21c1
Sequence:CCGGAGTTTCAACGAGACTTCATTTCTCGAGAAATGAAGTCTCGTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1369s21c1
Sequence:CCGGACTTCCACTGTGCGTTGTATGCTCGAGCATACAACGCACAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1433s21c1
Sequence:CCGGCTCTTAGGGTTTGGGATATTGCTCGAGCAATATCCCAAACCCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1665s21c1
Sequence:CCGGTGATACATCAATCCGTGTTTGCTCGAGCAAACACGGATTGATGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1604s21c1
Sequence:CCGGGGCATACTAATAGAGTCTATTCTCGAGAATAGACTCTATTAGTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-644s21c1
Sequence:CCGGGGCAACAACGACGCCGAATTACTCGAGTAATTCGGCGTCGTTGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1515s21c1
Sequence:CCGGTGATGGCAGGAGGGTTGTTAGCTCGAGCTAACAACCCTCCTGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018315.4-2389s21c1
Sequence:CCGGTCAAACCAGGTGCAATTATTTCTCGAGAAATAATTGCACCTGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018315.2-709s1c1
Sequence:CCGGCCTAAAGAGTTGGCACTCTATCTCGAGATAGAGTGCCAACTCTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018315.2-1438s1c1
Sequence:CCGGCCAGAGACTGAAACCTGTCTACTCGAGTAGACAGGTTTCAGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018315.2-1596s1c1
Sequence:CCGGCCAGTCGTTAACAAGTGGAATCTCGAGATTCCACTTGTTAACGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018315
FBXW7 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-451s21c1
Sequence:CCGGATGGGTTTCTACGGCACATTACTCGAGTAATGTGCCGTAGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018315.4-2135s21c1
Sequence:CCGGCCAATTGTGTAGACGATATACCTCGAGGTATATCGTCTACACAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-325s21c1
Sequence:CCGGTGCCTGAGCATGTCCACATTACTCGAGTAATGTGGACATGCTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018315.4-2507s21c1
Sequence:CCGGCTAGAAAGGAACTGCAATAATCTCGAGATTATTGCAGTTCCTTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-812s21c1
Sequence:CCGGAGTTTCAACGAGACTTCATTTCTCGAGAAATGAAGTCTCGTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1369s21c1
Sequence:CCGGACTTCCACTGTGCGTTGTATGCTCGAGCATACAACGCACAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1433s21c1
Sequence:CCGGCTCTTAGGGTTTGGGATATTGCTCGAGCAATATCCCAAACCCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1665s21c1
Sequence:CCGGTGATACATCAATCCGTGTTTGCTCGAGCAAACACGGATTGATGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1604s21c1
Sequence:CCGGGGCATACTAATAGAGTCTATTCTCGAGAATAGACTCTATTAGTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-644s21c1
Sequence:CCGGGGCAACAACGACGCCGAATTACTCGAGTAATTCGGCGTCGTTGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1515s21c1
Sequence:CCGGTGATGGCAGGAGGGTTGTTAGCTCGAGCTAACAACCCTCCTGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018315.4-2389s21c1
Sequence:CCGGTCAAACCAGGTGCAATTATTTCTCGAGAAATAATTGCACCTGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018315.2-709s1c1
Sequence:CCGGCCTAAAGAGTTGGCACTCTATCTCGAGATAGAGTGCCAACTCTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018315.2-1438s1c1
Sequence:CCGGCCAGAGACTGAAACCTGTCTACTCGAGTAGACAGGTTTCAGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018315.2-1596s1c1
Sequence:CCGGCCAGTCGTTAACAAGTGGAATCTCGAGATTCCACTTGTTAACGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018315
FBXW7 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-451s21c1
Sequence:CCGGATGGGTTTCTACGGCACATTACTCGAGTAATGTGCCGTAGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018315.4-2135s21c1
Sequence:CCGGCCAATTGTGTAGACGATATACCTCGAGGTATATCGTCTACACAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-325s21c1
Sequence:CCGGTGCCTGAGCATGTCCACATTACTCGAGTAATGTGGACATGCTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018315.4-2507s21c1
Sequence:CCGGCTAGAAAGGAACTGCAATAATCTCGAGATTATTGCAGTTCCTTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-812s21c1
Sequence:CCGGAGTTTCAACGAGACTTCATTTCTCGAGAAATGAAGTCTCGTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1369s21c1
Sequence:CCGGACTTCCACTGTGCGTTGTATGCTCGAGCATACAACGCACAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1433s21c1
Sequence:CCGGCTCTTAGGGTTTGGGATATTGCTCGAGCAATATCCCAAACCCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1665s21c1
Sequence:CCGGTGATACATCAATCCGTGTTTGCTCGAGCAAACACGGATTGATGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1604s21c1
Sequence:CCGGGGCATACTAATAGAGTCTATTCTCGAGAATAGACTCTATTAGTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-644s21c1
Sequence:CCGGGGCAACAACGACGCCGAATTACTCGAGTAATTCGGCGTCGTTGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018315.4-1515s21c1
Sequence:CCGGTGATGGCAGGAGGGTTGTTAGCTCGAGCTAACAACCCTCCTGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018315.4-2389s21c1
Sequence:CCGGTCAAACCAGGTGCAATTATTTCTCGAGAAATAATTGCACCTGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018315.2-709s1c1
Sequence:CCGGCCTAAAGAGTTGGCACTCTATCTCGAGATAGAGTGCCAACTCTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018315.2-1438s1c1
Sequence:CCGGCCAGAGACTGAAACCTGTCTACTCGAGTAGACAGGTTTCAGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018315.2-1596s1c1
Sequence:CCGGCCAGTCGTTAACAAGTGGAATCTCGAGATTCCACTTGTTAACGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks