EMAIL THIS PAGE TO A FRIEND

FBXW8

F-box and WD repeat domain containing 8

70 Gene Product Result for
Synonyms: FBW6 FBW8 FBX29 FBXO29 FBXW6
UniProtKB ID: Q8N3Y1, Q9UK95
Gene ID:
Human(26259) Summary: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains a WD-40 domain, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(231672) F-box and WD-40 domain protein 8
Rat(304522) F-box and WD repeat domain containing 8
Zebrafish(100136859) F-box and WD repeat domain containing 8
cow(787118) F-box and WD repeat domain containing 8
domestic cat(101091406) F-box and WD repeat domain containing 8
dog(486288) F-box and WD repeat domain containing 8
chicken(417024) F-box and WD repeat domain containing 8
domestic guinea pig(100728842) F-box and WD repeat domain containing 8
naked mole-rat(101714467) F-box and WD repeat domain containing 8
sheep(101108081) F-box and WD repeat domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012174 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012174 Rosetta Predictions human pricing
NM_153348 Rosetta Predictions human pricing
NM_001107145 Rosetta Predictions rat pricing
NM_172721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219916 predicted 701
2 SASI_Hs01_00219918 predicted 1111
3 SASI_Hs01_00219920 predicted 901
4 SASI_Hs01_00219922 predicted 1167
5 SASI_Hs01_00219923 predicted 940
6 SASI_Hs02_00343779 predicted 699
7 SASI_Hs02_00343780 predicted 878
8 SASI_Hs01_00219925 predicted 1157
9 SASI_Hs02_00343781 predicted 1665
10 SASI_Hs02_00343782 predicted 544
11 SASI_Hs01_00219917 predicted 1759
12 SASI_Hs01_00219919 predicted 718
13 SASI_Hs01_00219921 predicted 734
14 SASI_Hs01_00219924 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200847 predicted 900
2 SASI_Hs01_00200849 predicted 1304
3 SASI_Hs01_00200851 predicted 1101
4 SASI_Hs01_00200853 predicted 1364
5 SASI_Hs01_00200854 predicted 1142
6 SASI_Hs02_00367208 predicted 904
7 SASI_Hs02_00367209 predicted 1071
8 SASI_Hs01_00200856 predicted 1349
9 SASI_Hs02_00367210 predicted 1868
10 SASI_Hs02_00367211 predicted 747
11 SASI_Hs01_00200848 predicted 1952
12 SASI_Hs01_00200850 predicted 916
13 SASI_Hs01_00200852 predicted 938
14 SASI_Hs01_00200855 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225945 predicted 1499
2 SASI_Rn02_00225946 predicted 1068
3 SASI_Rn02_00225947 predicted 1141
4 SASI_Rn02_00225948 predicted 659
5 SASI_Rn02_00225949 predicted 2048
6 SASI_Rn02_00225950 predicted 2044
7 SASI_Rn02_00225951 predicted 860
8 SASI_Rn02_00225952 predicted 776
9 SASI_Rn02_00225953 predicted 1083
10 SASI_Rn02_00225954 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149693 predicted 429
2 SASI_Mm01_00149694 predicted 740
3 SASI_Mm01_00149695 predicted 447
4 SASI_Mm01_00149696 predicted 1371
5 SASI_Mm01_00149697 predicted 503
6 SASI_Mm01_00149698 predicted 1566
7 SASI_Mm01_00149699 predicted 849
8 SASI_Mm01_00149701 predicted 1811
9 SASI_Mm01_00149702 predicted 1283
10 SASI_Mm02_00344522 predicted 1692
11 SASI_Mm01_00149700 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012174
VALIDATED
FBXW8 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 8
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012174.x-1659s1c1
Sequence:CCGGCCTTTCCCTATAACCATGTTTCTCGAGAAACATGGTTATAGGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012174.x-197s1c1
Sequence:CCGGCCGGAGAATGAAATGAATGATCTCGAGATCATTCATTTCATTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012174.x-704s1c1
Sequence:CCGGGCAGCTTATGAGGATGGGTTTCTCGAGAAACCCATCCTCATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012174.x-2685s1c1
Sequence:CCGGGCCACAAAGAACAGCTCAGATCTCGAGATCTGAGCTGTTCTTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012174.x-546s1c1
Sequence:CCGGGTGTGGTCATTGCGGGATATACTCGAGTATATCCCGCAATGACCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-1116s21c1
Sequence:CCGGGAAGCAAGATCCTGGTGTATACTCGAGTATACACCAGGATCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-438s21c1
Sequence:CCGGGAGCCAAGGAACACATGTTACCTCGAGGTAACATGTGTTCCTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-881s21c1
Sequence:CCGGTGGCAGATAGCTGCGGAATTTCTCGAGAAATTCCGCAGCTATCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-245s21c1
Sequence:CCGGTACGAATTGGCAATCAATATACTCGAGTATATTGATTGCCAATTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-1371s21c1
Sequence:CCGGTGGTGTCCGTGTGGGATTATCCTCGAGGATAATCCCACACGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-770s21c1
Sequence:CCGGTTTGAGCACGATGCAAGAATACTCGAGTATTCTTGCATCGTGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-312s21c1
Sequence:CCGGGCAAGACGTGGAAGGTGATTGCTCGAGCAATCACCTTCCACGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-668s21c1
Sequence:CCGGGTCTCCTTTGTGAGGATAAACCTCGAGGTTTATCCTCACAAAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012174
VALIDATED
FBXW8 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 8
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012174.x-1659s1c1
Sequence:CCGGCCTTTCCCTATAACCATGTTTCTCGAGAAACATGGTTATAGGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012174.x-197s1c1
Sequence:CCGGCCGGAGAATGAAATGAATGATCTCGAGATCATTCATTTCATTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012174.x-704s1c1
Sequence:CCGGGCAGCTTATGAGGATGGGTTTCTCGAGAAACCCATCCTCATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012174.x-2685s1c1
Sequence:CCGGGCCACAAAGAACAGCTCAGATCTCGAGATCTGAGCTGTTCTTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012174.x-546s1c1
Sequence:CCGGGTGTGGTCATTGCGGGATATACTCGAGTATATCCCGCAATGACCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-1116s21c1
Sequence:CCGGGAAGCAAGATCCTGGTGTATACTCGAGTATACACCAGGATCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-438s21c1
Sequence:CCGGGAGCCAAGGAACACATGTTACCTCGAGGTAACATGTGTTCCTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-881s21c1
Sequence:CCGGTGGCAGATAGCTGCGGAATTTCTCGAGAAATTCCGCAGCTATCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-245s21c1
Sequence:CCGGTACGAATTGGCAATCAATATACTCGAGTATATTGATTGCCAATTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-1371s21c1
Sequence:CCGGTGGTGTCCGTGTGGGATTATCCTCGAGGATAATCCCACACGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-770s21c1
Sequence:CCGGTTTGAGCACGATGCAAGAATACTCGAGTATTCTTGCATCGTGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-312s21c1
Sequence:CCGGGCAAGACGTGGAAGGTGATTGCTCGAGCAATCACCTTCCACGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-668s21c1
Sequence:CCGGGTCTCCTTTGTGAGGATAAACCTCGAGGTTTATCCTCACAAAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012174
VALIDATED
FBXW8 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 8
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012174.x-1659s1c1
Sequence:CCGGCCTTTCCCTATAACCATGTTTCTCGAGAAACATGGTTATAGGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012174.x-197s1c1
Sequence:CCGGCCGGAGAATGAAATGAATGATCTCGAGATCATTCATTTCATTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012174.x-704s1c1
Sequence:CCGGGCAGCTTATGAGGATGGGTTTCTCGAGAAACCCATCCTCATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012174.x-2685s1c1
Sequence:CCGGGCCACAAAGAACAGCTCAGATCTCGAGATCTGAGCTGTTCTTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_012174.x-546s1c1
Sequence:CCGGGTGTGGTCATTGCGGGATATACTCGAGTATATCCCGCAATGACCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-1116s21c1
Sequence:CCGGGAAGCAAGATCCTGGTGTATACTCGAGTATACACCAGGATCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-438s21c1
Sequence:CCGGGAGCCAAGGAACACATGTTACCTCGAGGTAACATGTGTTCCTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-881s21c1
Sequence:CCGGTGGCAGATAGCTGCGGAATTTCTCGAGAAATTCCGCAGCTATCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-245s21c1
Sequence:CCGGTACGAATTGGCAATCAATATACTCGAGTATATTGATTGCCAATTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-1371s21c1
Sequence:CCGGTGGTGTCCGTGTGGGATTATCCTCGAGGATAATCCCACACGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-770s21c1
Sequence:CCGGTTTGAGCACGATGCAAGAATACTCGAGTATTCTTGCATCGTGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-312s21c1
Sequence:CCGGGCAAGACGTGGAAGGTGATTGCTCGAGCAATCACCTTCCACGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012174.1-668s21c1
Sequence:CCGGGTCTCCTTTGTGAGGATAAACCTCGAGGTTTATCCTCACAAAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172721
VALIDATED
FBXW8 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-506s1c1
Sequence:CCGGCCACAGCAGATTCTCCGATTACTCGAGTAATCGGAGAATCTGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172721.1-4014s1c1
Sequence:CCGGGCTGGCTTAGTGTTACTGTTTCTCGAGAAACAGTAACACTAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-375s1c1
Sequence:CCGGGCCATCAATATATTCCAGTATCTCGAGATACTGGAATATATTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-582s1c1
Sequence:CCGGGCCAACTGGAAGAATCGCAAACTCGAGTTTGCGATTCTTCCAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-1034s1c1
Sequence:CCGGGCTGGTTGACTACCTTGAAATCTCGAGATTTCAAGGTAGTCAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-654s21c1
Sequence:CCGGGCCAACTGGAAGAATCGCAAACTCGAGTTTGCGATTCTTCCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-447s21c1
Sequence:CCGGGCCATCAATATATTCCAGTATCTCGAGATACTGGAATATATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-1106s21c1
Sequence:CCGGGCTGGTTGACTACCTTGAAATCTCGAGATTTCAAGGTAGTCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-578s21c1
Sequence:CCGGCCACAGCAGATTCTCCGATTACTCGAGTAATCGGAGAATCTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172721
VALIDATED
FBXW8 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-506s1c1
Sequence:CCGGCCACAGCAGATTCTCCGATTACTCGAGTAATCGGAGAATCTGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172721.1-4014s1c1
Sequence:CCGGGCTGGCTTAGTGTTACTGTTTCTCGAGAAACAGTAACACTAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-375s1c1
Sequence:CCGGGCCATCAATATATTCCAGTATCTCGAGATACTGGAATATATTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-582s1c1
Sequence:CCGGGCCAACTGGAAGAATCGCAAACTCGAGTTTGCGATTCTTCCAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-1034s1c1
Sequence:CCGGGCTGGTTGACTACCTTGAAATCTCGAGATTTCAAGGTAGTCAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-654s21c1
Sequence:CCGGGCCAACTGGAAGAATCGCAAACTCGAGTTTGCGATTCTTCCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-447s21c1
Sequence:CCGGGCCATCAATATATTCCAGTATCTCGAGATACTGGAATATATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-1106s21c1
Sequence:CCGGGCTGGTTGACTACCTTGAAATCTCGAGATTTCAAGGTAGTCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-578s21c1
Sequence:CCGGCCACAGCAGATTCTCCGATTACTCGAGTAATCGGAGAATCTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172721
VALIDATED
FBXW8 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-506s1c1
Sequence:CCGGCCACAGCAGATTCTCCGATTACTCGAGTAATCGGAGAATCTGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172721.1-4014s1c1
Sequence:CCGGGCTGGCTTAGTGTTACTGTTTCTCGAGAAACAGTAACACTAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-375s1c1
Sequence:CCGGGCCATCAATATATTCCAGTATCTCGAGATACTGGAATATATTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-582s1c1
Sequence:CCGGGCCAACTGGAAGAATCGCAAACTCGAGTTTGCGATTCTTCCAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172721.1-1034s1c1
Sequence:CCGGGCTGGTTGACTACCTTGAAATCTCGAGATTTCAAGGTAGTCAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-654s21c1
Sequence:CCGGGCCAACTGGAAGAATCGCAAACTCGAGTTTGCGATTCTTCCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-447s21c1
Sequence:CCGGGCCATCAATATATTCCAGTATCTCGAGATACTGGAATATATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-1106s21c1
Sequence:CCGGGCTGGTTGACTACCTTGAAATCTCGAGATTTCAAGGTAGTCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172721.2-578s21c1
Sequence:CCGGCCACAGCAGATTCTCCGATTACTCGAGTAATCGGAGAATCTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks