EMAIL THIS PAGE TO A FRIEND

FBXW9

F-box and WD repeat domain containing 9

Synonyms: Fbw9
UniProtKB ID: Q5XUX1, B3KVP7, Q9BT89
Gene ID:
Human(84261) Summary: Members of the F-box protein family, such as FBXW9, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603034), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(68628) F-box and WD-40 domain protein 9
Rat(288921) F-box and WD repeat domain containing 9
sheep(101106768) F-box and WD repeat domain containing 9
naked mole-rat(101709753) F-box and WD repeat domain containing 9
domestic guinea pig(100717363) F-box and WD repeat domain containing 9
Zebrafish(100330184) F-box and WD repeat domain containing 9
dog(476701) F-box and WD repeat domain containing 9
cow(532538) F-box and WD repeat domain containing 9
domestic cat(101084604) F-box and WD repeat domain containing 9
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032301 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032301 Rosetta Predictions human pricing
NM_001081634 Rosetta Predictions rat pricing
XM_213838 Rosetta Predictions rat pricing
NM_026791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359639 predicted 999
2 SASI_Hs02_00359640 predicted 891
3 SASI_Hs02_00359641 predicted 951
4 SASI_Hs02_00359642 predicted 612
5 SASI_Hs01_00121601 predicted 1320
6 SASI_Hs02_00359643 predicted 1322
7 SASI_Hs02_00359644 predicted 637
8 SASI_Hs02_00359645 predicted 1331
9 SASI_Hs02_00359646 predicted 1221
10 SASI_Hs02_00359647 predicted 823
11 SASI_Hs01_00121597 predicted 1205
12 SASI_Hs01_00121598 predicted 1317
13 SASI_Hs01_00121599 predicted 1327
14 SASI_Hs01_00121600 predicted 1167
15 SASI_Hs01_00121602 predicted 1176
16 SASI_Hs01_00121603 predicted 1241
17 SASI_Hs01_00121604 predicted 1252
18 SASI_Hs01_00121605 predicted 1377
19 SASI_Hs01_00121606 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208619 predicted 465
2 SASI_Rn02_00208620 predicted 1373
3 SASI_Rn02_00208621 predicted 1218
4 SASI_Rn02_00208622 predicted 749
5 SASI_Rn02_00208623 predicted 1292
6 SASI_Rn02_00208624 predicted 982
7 SASI_Rn02_00208625 predicted 1426
8 SASI_Rn02_00208626 predicted 804
9 SASI_Rn02_00208627 predicted 1061
10 SASI_Rn02_00208628 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374946 predicted 473
2 SASI_Rn02_00374947 predicted 608
3 SASI_Rn02_00374948 predicted 258
4 SASI_Rn02_00374949 predicted 282
5 SASI_Rn02_00374950 predicted 274
6 SASI_Rn02_00374951 predicted 576
7 SASI_Rn02_00374952 predicted 577
8 SASI_Rn02_00374953 predicted 458
9 SASI_Rn02_00374954 predicted 579
10 SASI_Rn02_00374955 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117671 predicted 867
2 SASI_Mm02_00330898 predicted 646
3 SASI_Mm02_00330899 predicted 763
4 SASI_Mm02_00330900 predicted 197
5 SASI_Mm01_00117673 predicted 1221
6 SASI_Mm02_00330901 predicted 1079
7 SASI_Mm01_00117676 predicted 992
8 SASI_Mm02_00330902 predicted 439
9 SASI_Mm01_00117677 predicted 1239
10 SASI_Mm02_00330903 predicted 206
11 SASI_Mm01_00117672 predicted 1314
12 SASI_Mm01_00117674 predicted 1366
13 SASI_Mm01_00117675 predicted 1335
14 SASI_Mm01_00117678 predicted 1189
15 SASI_Mm01_00117679 predicted 1737
16 SASI_Mm01_00117680 predicted 1307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032301
FBXW9 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 9
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000257158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032301.2-1476s21c1
Sequence:CCGGTGGGCTTCCTCCTCTGTTCTTCTCGAGAAGAACAGAGGAGGAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032301.2-1340s21c1
Sequence:CCGGGGCATGACAATGGGCTCAATACTCGAGTATTGAGCCCATTGTCATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032301.2-708s21c1
Sequence:CCGGCTTAGGCACTAAGCGAAATAGCTCGAGCTATTTCGCTTAGTGCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032301.2-831s21c1
Sequence:CCGGGCAGCAGTTCGGCGAGATAAACTCGAGTTTATCTCGCCGAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032301
FBXW9 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 9
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000257158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032301.2-1476s21c1
Sequence:CCGGTGGGCTTCCTCCTCTGTTCTTCTCGAGAAGAACAGAGGAGGAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032301.2-1340s21c1
Sequence:CCGGGGCATGACAATGGGCTCAATACTCGAGTATTGAGCCCATTGTCATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032301.2-708s21c1
Sequence:CCGGCTTAGGCACTAAGCGAAATAGCTCGAGCTATTTCGCTTAGTGCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032301.2-831s21c1
Sequence:CCGGGCAGCAGTTCGGCGAGATAAACTCGAGTTTATCTCGCCGAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032301
FBXW9 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 9
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000257158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032301.2-1476s21c1
Sequence:CCGGTGGGCTTCCTCCTCTGTTCTTCTCGAGAAGAACAGAGGAGGAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032301.2-1340s21c1
Sequence:CCGGGGCATGACAATGGGCTCAATACTCGAGTATTGAGCCCATTGTCATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032301.2-708s21c1
Sequence:CCGGCTTAGGCACTAAGCGAAATAGCTCGAGCTATTTCGCTTAGTGCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032301.2-831s21c1
Sequence:CCGGGCAGCAGTTCGGCGAGATAAACTCGAGTTTATCTCGCCGAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026791
FBXW9 MISSION shRNA Bacterial Glycerol Stock
F-box and WD repeat domain containing 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1178s21c1
Sequence:CCGGCTCAGATCACAGGGATCAAACCTCGAGGTTTGATCCCTGTGATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026791.2-1406s21c1
Sequence:CCGGTGTGGATGGATGTTGGTATAGCTCGAGCTATACCAACATCCATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1051s21c1
Sequence:CCGGTATCTCCTGTGCATGTCTTACCTCGAGGTAAGACATGCACAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1002s21c1
Sequence:CCGGATTTGATCGTCGAGCCAATAGCTCGAGCTATTGGCTCGACGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1286s21c1
Sequence:CCGGGAAGCCACCACAACGTGTTAACTCGAGTTAACACGTTGTGGTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026791.1-1704s1c1
Sequence:CCGGGTACACAACATCTACTGACAACTCGAGTTGTCAGTAGATGTTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026791.1-1539s1c1
Sequence:CCGGCTATCTCCTGTGCATGTCTTACTCGAGTAAGACATGCACAGGAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026791.1-1311s1c1
Sequence:CCGGCCTTTCCTACCAACCTGATATCTCGAGATATCAGGTTGGTAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026791
FBXW9 MISSION shRNA shRNA Plasmid DNA
F-box and WD repeat domain containing 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1178s21c1
Sequence:CCGGCTCAGATCACAGGGATCAAACCTCGAGGTTTGATCCCTGTGATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026791.2-1406s21c1
Sequence:CCGGTGTGGATGGATGTTGGTATAGCTCGAGCTATACCAACATCCATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1051s21c1
Sequence:CCGGTATCTCCTGTGCATGTCTTACCTCGAGGTAAGACATGCACAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1002s21c1
Sequence:CCGGATTTGATCGTCGAGCCAATAGCTCGAGCTATTGGCTCGACGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1286s21c1
Sequence:CCGGGAAGCCACCACAACGTGTTAACTCGAGTTAACACGTTGTGGTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026791.1-1704s1c1
Sequence:CCGGGTACACAACATCTACTGACAACTCGAGTTGTCAGTAGATGTTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026791.1-1539s1c1
Sequence:CCGGCTATCTCCTGTGCATGTCTTACTCGAGTAAGACATGCACAGGAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026791.1-1311s1c1
Sequence:CCGGCCTTTCCTACCAACCTGATATCTCGAGATATCAGGTTGGTAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026791
FBXW9 MISSION shRNA Lentiviral Transduction Particles
F-box and WD repeat domain containing 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1178s21c1
Sequence:CCGGCTCAGATCACAGGGATCAAACCTCGAGGTTTGATCCCTGTGATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026791.2-1406s21c1
Sequence:CCGGTGTGGATGGATGTTGGTATAGCTCGAGCTATACCAACATCCATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1051s21c1
Sequence:CCGGTATCTCCTGTGCATGTCTTACCTCGAGGTAAGACATGCACAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1002s21c1
Sequence:CCGGATTTGATCGTCGAGCCAATAGCTCGAGCTATTGGCTCGACGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026791.2-1286s21c1
Sequence:CCGGGAAGCCACCACAACGTGTTAACTCGAGTTAACACGTTGTGGTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026791.1-1704s1c1
Sequence:CCGGGTACACAACATCTACTGACAACTCGAGTTGTCAGTAGATGTTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026791.1-1539s1c1
Sequence:CCGGCTATCTCCTGTGCATGTCTTACTCGAGTAAGACATGCACAGGAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026791.1-1311s1c1
Sequence:CCGGCCTTTCCTACCAACCTGATATCTCGAGATATCAGGTTGGTAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks