EMAIL THIS PAGE TO A FRIEND

FCAMR

Fc receptor, IgA, IgM, high affinity

78 Gene Product Result for
Synonyms: CD351 FCA/MR
UniProtKB ID: Q8WWV6, Q32M82, Q8WWV5, Q96SA2
Gene ID:
Mouse(64435) Fc receptor, IgA, IgM, high affinity
Rat(681070) Fc receptor, IgA, IgM, high affinity
cow(100297408) Fc receptor, IgA, IgM, high affinity
dog(490267) Fc receptor, IgA, IgM, high affinity
domestic cat(101095394) Fc receptor, IgA, IgM, high affinity
sheep(101113948) Fc receptor, IgA, IgM, high affinity
domestic guinea pig(100714785) Fc receptor, IgA, IgM, high affinity
naked mole-rat(101706443) Fc receptor, IgA, IgM, high affinity
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107548 Anti-FCAMR antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032029 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122979 Rosetta Predictions human pricing
NM_001122980 Rosetta Predictions human pricing
NM_032029 Rosetta Predictions human pricing
XM_001060181 Rosetta Predictions rat pricing
NM_144960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327636 predicted 1274
2 SASI_Hs02_00327637 predicted 811
3 SASI_Hs02_00327638 predicted 815
4 SASI_Hs02_00327639 predicted 1205
5 SASI_Hs02_00327640 predicted 715
6 SASI_Hs02_00327641 predicted 1193
7 SASI_Hs02_00327642 predicted 1188
8 SASI_Hs02_00327643 predicted 1131
9 SASI_Hs02_00327644 predicted 488
10 SASI_Hs02_00327645 predicted 1357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327646 predicted 2084
2 SASI_Hs02_00327647 predicted 822
3 SASI_Hs02_00327648 predicted 2154
4 SASI_Hs02_00327649 predicted 820
5 SASI_Hs02_00327650 predicted 2008
6 SASI_Hs02_00327651 predicted 726
7 SASI_Hs02_00327652 predicted 2001
8 SASI_Hs02_00327653 predicted 2001
9 SASI_Hs02_00327654 predicted 1947
10 SASI_Hs02_00327655 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359218 predicted 1361
2 SASI_Hs02_00359219 predicted 893
3 SASI_Hs02_00359220 predicted 901
4 SASI_Hs01_00178396 predicted 1286
5 SASI_Hs02_00359221 predicted 796
6 SASI_Hs01_00178399 predicted 1275
7 SASI_Hs01_00178398 predicted 1273
8 SASI_Hs02_00359222 predicted 1216
9 SASI_Hs02_00359223 predicted 574
10 SASI_Hs02_00359224 predicted 1433
11 SASI_Hs01_00178395 predicted 1493
12 SASI_Hs01_00178397 predicted 482
13 SASI_Hs01_00178400 predicted 1037
14 SASI_Hs01_00178401 predicted 852
15 SASI_Hs01_00178402 predicted 1125
16 SASI_Hs01_00178403 predicted 422
17 SASI_Hs01_00178404 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295641 predicted 496
2 SASI_Rn02_00295642 predicted 464
3 SASI_Rn02_00295643 predicted 1075
4 SASI_Rn02_00295644 predicted 1133
5 SASI_Rn02_00295645 predicted 651
6 SASI_Rn02_00295646 predicted 1254
7 SASI_Rn02_00295647 predicted 1249
8 SASI_Rn02_00295648 predicted 1057
9 SASI_Rn02_00295649 predicted 288
10 SASI_Rn02_00295650 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340487 predicted 276
2 SASI_Mm01_00035118 predicted 1031
3 SASI_Mm01_00035119 predicted 970
4 SASI_Mm01_00035120 predicted 1190
5 SASI_Mm01_00035121 predicted 499
6 SASI_Mm01_00035122 predicted 1270
7 SASI_Mm01_00035123 predicted 807
8 SASI_Mm02_00340488 predicted 747
9 SASI_Mm01_00035124 predicted 731
10 SASI_Mm02_00340489 predicted 1119
11 SASI_Mm01_00035125 predicted 996
12 SASI_Mm01_00035126 predicted 776
13 SASI_Mm01_00035127 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032029
FCAMR MISSION shRNA Bacterial Glycerol Stock
Fc receptor, IgA, IgM, high affinity
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-908s1c1
Sequence:CCGGCCAATACAACAGAAGGTGTTTCTCGAGAAACACCTTCTGTTGTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-1385s1c1
Sequence:CCGGGCCCAGGTTTAAGTACTCTTACTCGAGTAAGAGTACTTAAACCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-265s1c1
Sequence:CCGGCCAAATTCATTGAAGGGCTCACTCGAGTGAGCCCTTCAATGAATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-1129s1c1
Sequence:CCGGGCAACGCCAGTTTCTAAGCAACTCGAGTTGCTTAGAAACTGGCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-1490s1c1
Sequence:CCGGCCTTAATTCAGATGACACATTCTCGAGAATGTGTCATCTGAATTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032029.4-660s21c1
Sequence:CCGGCTGCTACAAGGTTCTTCTTTCCTCGAGGAAAGAAGAACCTTGTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032029.4-1742s21c1
Sequence:CCGGTCAGTGTGGAAAGTGACAAATCTCGAGATTTGTCACTTTCCACACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032029.4-1592s21c1
Sequence:CCGGCCCAAGAAAGTCAAGCATTATCTCGAGATAATGCTTGACTTTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032029
FCAMR MISSION shRNA shRNA Plasmid DNA
Fc receptor, IgA, IgM, high affinity
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-908s1c1
Sequence:CCGGCCAATACAACAGAAGGTGTTTCTCGAGAAACACCTTCTGTTGTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-1385s1c1
Sequence:CCGGGCCCAGGTTTAAGTACTCTTACTCGAGTAAGAGTACTTAAACCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-265s1c1
Sequence:CCGGCCAAATTCATTGAAGGGCTCACTCGAGTGAGCCCTTCAATGAATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-1129s1c1
Sequence:CCGGGCAACGCCAGTTTCTAAGCAACTCGAGTTGCTTAGAAACTGGCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-1490s1c1
Sequence:CCGGCCTTAATTCAGATGACACATTCTCGAGAATGTGTCATCTGAATTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032029.4-660s21c1
Sequence:CCGGCTGCTACAAGGTTCTTCTTTCCTCGAGGAAAGAAGAACCTTGTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032029.4-1742s21c1
Sequence:CCGGTCAGTGTGGAAAGTGACAAATCTCGAGATTTGTCACTTTCCACACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032029.4-1592s21c1
Sequence:CCGGCCCAAGAAAGTCAAGCATTATCTCGAGATAATGCTTGACTTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032029
FCAMR MISSION shRNA Lentiviral Transduction Particles
Fc receptor, IgA, IgM, high affinity
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-908s1c1
Sequence:CCGGCCAATACAACAGAAGGTGTTTCTCGAGAAACACCTTCTGTTGTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-1385s1c1
Sequence:CCGGGCCCAGGTTTAAGTACTCTTACTCGAGTAAGAGTACTTAAACCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-265s1c1
Sequence:CCGGCCAAATTCATTGAAGGGCTCACTCGAGTGAGCCCTTCAATGAATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-1129s1c1
Sequence:CCGGGCAACGCCAGTTTCTAAGCAACTCGAGTTGCTTAGAAACTGGCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032029.1-1490s1c1
Sequence:CCGGCCTTAATTCAGATGACACATTCTCGAGAATGTGTCATCTGAATTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032029.4-660s21c1
Sequence:CCGGCTGCTACAAGGTTCTTCTTTCCTCGAGGAAAGAAGAACCTTGTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032029.4-1742s21c1
Sequence:CCGGTCAGTGTGGAAAGTGACAAATCTCGAGATTTGTCACTTTCCACACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032029.4-1592s21c1
Sequence:CCGGCCCAAGAAAGTCAAGCATTATCTCGAGATAATGCTTGACTTTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144960
FCAMR MISSION shRNA Bacterial Glycerol Stock
Fc receptor, IgA, IgM, high affinity
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-1468s1c1
Sequence:CCGGGCTGCTCTGATCCTATTGAAACTCGAGTTTCAATAGGATCAGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-285s1c1
Sequence:CCGGGAACTCCCTTTCAGGTACAAACTCGAGTTTGTACCTGAAAGGGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-1544s1c1
Sequence:CCGGCTCTAATTCAGATGACACATTCTCGAGAATGTGTCATCTGAATTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-1458s1c1
Sequence:CCGGGCTTCTAATTGCTGCTCTGATCTCGAGATCAGAGCAGCAATTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-379s1c1
Sequence:CCGGTCCTCAGTCAACAGGCATCAACTCGAGTTGATGCCTGTTGACTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144960.2-1213s21c1
Sequence:CCGGCCAAGTGCACAGACCTTAAATCTCGAGATTTAAGGTCTGTGCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144960.2-590s21c1
Sequence:CCGGTGCTATTCTTCAGCGTGAATCCTCGAGGATTCACGCTGAAGAATAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144960.2-1161s21c1
Sequence:CCGGAGAGGTGTCTAAGCAACAAATCTCGAGATTTGTTGCTTAGACACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144960
FCAMR MISSION shRNA shRNA Plasmid DNA
Fc receptor, IgA, IgM, high affinity
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-1468s1c1
Sequence:CCGGGCTGCTCTGATCCTATTGAAACTCGAGTTTCAATAGGATCAGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-285s1c1
Sequence:CCGGGAACTCCCTTTCAGGTACAAACTCGAGTTTGTACCTGAAAGGGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-1544s1c1
Sequence:CCGGCTCTAATTCAGATGACACATTCTCGAGAATGTGTCATCTGAATTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-1458s1c1
Sequence:CCGGGCTTCTAATTGCTGCTCTGATCTCGAGATCAGAGCAGCAATTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-379s1c1
Sequence:CCGGTCCTCAGTCAACAGGCATCAACTCGAGTTGATGCCTGTTGACTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144960.2-1213s21c1
Sequence:CCGGCCAAGTGCACAGACCTTAAATCTCGAGATTTAAGGTCTGTGCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144960.2-590s21c1
Sequence:CCGGTGCTATTCTTCAGCGTGAATCCTCGAGGATTCACGCTGAAGAATAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144960.2-1161s21c1
Sequence:CCGGAGAGGTGTCTAAGCAACAAATCTCGAGATTTGTTGCTTAGACACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144960
FCAMR MISSION shRNA Lentiviral Transduction Particles
Fc receptor, IgA, IgM, high affinity
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-1468s1c1
Sequence:CCGGGCTGCTCTGATCCTATTGAAACTCGAGTTTCAATAGGATCAGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-285s1c1
Sequence:CCGGGAACTCCCTTTCAGGTACAAACTCGAGTTTGTACCTGAAAGGGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-1544s1c1
Sequence:CCGGCTCTAATTCAGATGACACATTCTCGAGAATGTGTCATCTGAATTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-1458s1c1
Sequence:CCGGGCTTCTAATTGCTGCTCTGATCTCGAGATCAGAGCAGCAATTAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144960.1-379s1c1
Sequence:CCGGTCCTCAGTCAACAGGCATCAACTCGAGTTGATGCCTGTTGACTGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144960.2-1213s21c1
Sequence:CCGGCCAAGTGCACAGACCTTAAATCTCGAGATTTAAGGTCTGTGCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144960.2-590s21c1
Sequence:CCGGTGCTATTCTTCAGCGTGAATCCTCGAGGATTCACGCTGAAGAATAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144960.2-1161s21c1
Sequence:CCGGAGAGGTGTCTAAGCAACAAATCTCGAGATTTGTTGCTTAGACACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)