EMAIL THIS PAGE TO A FRIEND

FCAR

Fc fragment of IgA, receptor for

202 Gene Product Result for
Synonyms: CD89
Gene ID:
Human(2204) Summary: This gene is a member of the immunoglobulin gene superfamily and encodes a receptor for the Fc region of IgA. The receptor is a transmembrane glycoprotein present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, where it mediates immunologic responses to pathogens. It interacts with IgA-opsonized targets and triggers several immunologic defense processes, including phagocytosis, antibody-dependent cell-mediated cytotoxicity, and stimulation of the release of inflammatory mediators. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Rat(365183) Fc fragment of IgA, receptor for
domestic guinea pig(100716057) Fc fragment of IgA, receptor for
cow(503555) Fc fragment of IgA, receptor for
Horse(100050205) Fc fragment of IgA, receptor for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1448 Human FCAR ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002000 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002000 Rosetta Predictions human pricing
NM_133269 Rosetta Predictions human pricing
NM_133271 Rosetta Predictions human pricing
NM_133272 Rosetta Predictions human pricing
NM_133273 Rosetta Predictions human pricing
NM_133274 Rosetta Predictions human pricing
NM_133277 Rosetta Predictions human pricing
NM_133278 Rosetta Predictions human pricing
NM_133279 Rosetta Predictions human pricing
NM_133280 Rosetta Predictions human pricing
NM_201992 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332995 predicted 1014
2 SASI_Hs02_00332996 predicted 309
3 SASI_Hs02_00332997 predicted 1506
4 SASI_Hs02_00332998 predicted 292
5 SASI_Hs02_00332999 predicted 437
6 SASI_Hs01_00189799 predicted 490
7 SASI_Hs02_00333000 predicted 1533
8 SASI_Hs02_00333001 predicted 1048
9 SASI_Hs01_00189807 predicted 508
10 SASI_Hs02_00333002 predicted 427
11 SASI_Hs01_00189798 predicted 547
12 SASI_Hs01_00189800 predicted 480
13 SASI_Hs01_00189801 predicted 480
14 SASI_Hs01_00189802 predicted 506
15 SASI_Hs01_00189803 predicted 485
16 SASI_Hs01_00189804 predicted 485
17 SASI_Hs01_00189805 predicted 515
18 SASI_Hs01_00189806 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071273 predicted 948
2 SASI_Hs01_00071274 predicted 310
3 SASI_Hs02_00362970 predicted 1445
4 SASI_Hs01_00071275 predicted 292
5 SASI_Hs02_00362971 predicted 442
6 SASI_Hs01_00071276 predicted 487
7 SASI_Hs01_00071277 predicted 1467
8 SASI_Hs01_00071279 predicted 985
9 SASI_Hs01_00071280 predicted 504
10 SASI_Hs01_00071281 predicted 423
11 SASI_Hs01_00071278 predicted 846
12 SASI_Hs01_00071282 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120082 predicted 728
2 SASI_Hs01_00120083 predicted 295
3 SASI_Hs01_00120084 predicted 487
4 SASI_Hs01_00120085 predicted 475
5 SASI_Hs01_00120086 predicted 713
6 SASI_Hs01_00120087 predicted 502
7 SASI_Hs01_00120089 predicted 304
8 SASI_Hs01_00120090 predicted 575
9 SASI_Hs01_00120091 predicted 398
10 SASI_Hs02_00362972 predicted 549
11 SASI_Hs01_00120088 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140317 predicted 986
2 SASI_Hs01_00140318 predicted 279
3 SASI_Hs02_00362973 predicted 1471
4 SASI_Hs01_00140319 predicted 258
5 SASI_Hs02_00362974 predicted 399
6 SASI_Hs01_00140320 predicted 453
7 SASI_Hs01_00140321 predicted 1503
8 SASI_Hs01_00140323 predicted 1014
9 SASI_Hs01_00140324 predicted 474
10 SASI_Hs01_00140325 predicted 387
11 SASI_Hs01_00140322 predicted 876
12 SASI_Hs01_00140326 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223323 predicted 690
2 SASI_Hs01_00223324 predicted 250
3 SASI_Hs01_00223325 predicted 450
4 SASI_Hs01_00223326 predicted 441
5 SASI_Hs01_00223327 predicted 674
6 SASI_Hs01_00223328 predicted 468
7 SASI_Hs01_00223330 predicted 271
8 SASI_Hs01_00223331 predicted 539
9 SASI_Hs01_00223332 predicted 365
10 SASI_Hs02_00362975 predicted 513
11 SASI_Hs01_00223329 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043460 predicted 907
2 SASI_Hs01_00043461 predicted 256
3 SASI_Hs01_00043462 predicted 455
4 SASI_Hs01_00043463 predicted 446
5 SASI_Hs01_00043464 predicted 890
6 SASI_Hs01_00043465 predicted 470
7 SASI_Hs01_00043467 predicted 728
8 SASI_Hs01_00043469 predicted 271
9 SASI_Hs02_00362976 predicted 752
10 SASI_Hs02_00362977 predicted 365
11 SASI_Hs01_00043466 predicted 604
12 SASI_Hs01_00043468 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362978 predicted 689
2 SASI_Hs02_00362979 predicted 670
3 SASI_Hs02_00362980 predicted 211
4 SASI_Hs01_00162738 predicted 437
5 SASI_Hs02_00362981 predicted 212
6 SASI_Hs02_00362982 predicted 586
7 SASI_Hs02_00362983 predicted 216
8 SASI_Hs01_00162740 predicted 537
9 SASI_Hs02_00362984 predicted 511
10 SASI_Hs02_00362985 predicted 727
11 SASI_Hs01_00162736 predicted 533
12 SASI_Hs01_00162737 predicted 448
13 SASI_Hs01_00162739 predicted 588
14 SASI_Hs01_00162741 predicted 440
15 SASI_Hs01_00162742 predicted 495
16 SASI_Hs01_00162743 predicted 506
17 SASI_Hs01_00162744 predicted 597
18 SASI_Hs01_00162745 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223723 predicted 919
2 SASI_Hs01_00223724 predicted 277
3 SASI_Hs02_00362986 predicted 1405
4 SASI_Hs01_00223725 predicted 252
5 SASI_Hs02_00362987 predicted 400
6 SASI_Hs01_00223726 predicted 452
7 SASI_Hs01_00223727 predicted 1431
8 SASI_Hs01_00223729 predicted 949
9 SASI_Hs01_00223730 predicted 474
10 SASI_Hs01_00223731 predicted 390
11 SASI_Hs01_00223728 predicted 809
12 SASI_Hs01_00223732 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065360 predicted 536
2 SASI_Hs01_00065363 predicted 487
3 SASI_Hs01_00065361 predicted 480
4 SASI_Hs02_00362988 predicted 474
5 SASI_Hs02_00362989 predicted 503
6 SASI_Hs01_00065365 predicted 483
7 SASI_Hs02_00362990 predicted 479
8 SASI_Hs02_00362991 predicted 506
9 SASI_Hs02_00362992 predicted 549
10 SASI_Hs02_00362993 predicted 510
11 SASI_Hs01_00065362 predicted 510
12 SASI_Hs01_00065364 predicted 776
13 SASI_Hs01_00065366 predicted 518
14 SASI_Hs01_00065367 predicted 716
15 SASI_Hs01_00065368 predicted 607
16 SASI_Hs01_00065369 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239343 predicted 505
2 SASI_Hs01_00239344 predicted 454
3 SASI_Hs01_00239345 predicted 477
4 SASI_Hs01_00239346 predicted 463
5 SASI_Hs01_00239347 predicted 734
6 SASI_Hs01_00239348 predicted 447
7 SASI_Hs01_00239349 predicted 472
8 SASI_Hs01_00239350 predicted 673
9 SASI_Hs01_00239351 predicted 568
10 SASI_Hs01_00239352 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091501 predicted 405
2 SASI_Rn02_00270350 predicted 435
3 SASI_Rn01_00091502 predicted 304
4 SASI_Rn02_00270351 predicted 598
5 SASI_Rn01_00091504 predicted 528
6 SASI_Rn01_00091505 predicted 851
7 SASI_Rn01_00091506 predicted 746
8 SASI_Rn01_00091507 predicted 935
9 SASI_Rn01_00091508 predicted 799
10 SASI_Rn01_00091509 predicted 706
11 SASI_Rn01_00091503 predicted 669
12 SASI_Rn01_00091510 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002000
FCAR MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgA, receptor for
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002000.2-368s21c1
Sequence:CCGGGACCCAGCTGATGATCATAAACTCGAGTTTATGATCATCAGCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002000.2-439s21c1
Sequence:CCGGCTGATCCTGAGTTCGTCATTGCTCGAGCAATGACGAACTCAGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002000.2-1486s21c1
Sequence:CCGGTTATGCAGGACTGATCGATTTCTCGAGAAATCGATCAGTCCTGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-857s1c1
Sequence:CCGGCCAAGATTACACGACGCAGAACTCGAGTTCTGCGTCGTGTAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-497s1c1
Sequence:CCGGCCAATATAGGATAGGGCACTACTCGAGTAGTGCCCTATCCTATATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-315s1c1
Sequence:CCGGCCCTTGGATGGATCTGTGAAACTCGAGTTTCACAGATCCATCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-749s1c1
Sequence:CCGGCCTCAATGTCTCAGGGATCTACTCGAGTAGATCCCTGAGACATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-645s1c1
Sequence:CCGGCACATCCCATTTGATAGATTTCTCGAGAAATCTATCAAATGGGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002000
FCAR MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgA, receptor for
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002000.2-368s21c1
Sequence:CCGGGACCCAGCTGATGATCATAAACTCGAGTTTATGATCATCAGCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002000.2-439s21c1
Sequence:CCGGCTGATCCTGAGTTCGTCATTGCTCGAGCAATGACGAACTCAGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002000.2-1486s21c1
Sequence:CCGGTTATGCAGGACTGATCGATTTCTCGAGAAATCGATCAGTCCTGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-857s1c1
Sequence:CCGGCCAAGATTACACGACGCAGAACTCGAGTTCTGCGTCGTGTAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-497s1c1
Sequence:CCGGCCAATATAGGATAGGGCACTACTCGAGTAGTGCCCTATCCTATATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-315s1c1
Sequence:CCGGCCCTTGGATGGATCTGTGAAACTCGAGTTTCACAGATCCATCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-749s1c1
Sequence:CCGGCCTCAATGTCTCAGGGATCTACTCGAGTAGATCCCTGAGACATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-645s1c1
Sequence:CCGGCACATCCCATTTGATAGATTTCTCGAGAAATCTATCAAATGGGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002000
FCAR MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgA, receptor for
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002000.2-368s21c1
Sequence:CCGGGACCCAGCTGATGATCATAAACTCGAGTTTATGATCATCAGCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002000.2-439s21c1
Sequence:CCGGCTGATCCTGAGTTCGTCATTGCTCGAGCAATGACGAACTCAGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002000.2-1486s21c1
Sequence:CCGGTTATGCAGGACTGATCGATTTCTCGAGAAATCGATCAGTCCTGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-857s1c1
Sequence:CCGGCCAAGATTACACGACGCAGAACTCGAGTTCTGCGTCGTGTAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-497s1c1
Sequence:CCGGCCAATATAGGATAGGGCACTACTCGAGTAGTGCCCTATCCTATATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-315s1c1
Sequence:CCGGCCCTTGGATGGATCTGTGAAACTCGAGTTTCACAGATCCATCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-749s1c1
Sequence:CCGGCCTCAATGTCTCAGGGATCTACTCGAGTAGATCCCTGAGACATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002000.2-645s1c1
Sequence:CCGGCACATCCCATTTGATAGATTTCTCGAGAAATCTATCAAATGGGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks