EMAIL THIS PAGE TO A FRIEND

FCER1A

Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide

69 Gene Product Result for
Synonyms: FCE1A FcERI
UniProtKB ID: P12319
Gene ID:
Human(2205) Summary: The immunoglobulin epsilon receptor (IgE receptor) is the initiator of the allergic response. When two or more high-affinity IgE receptors are brought together by allergen-bound IgE molecules, mediators such as histamine that are responsible for allergy symptoms are released. This receptor is comprised of an alpha subunit, a beta subunit, and two gamma subunits. The protein encoded by this gene represents the alpha subunit. [provided by RefSeq, Aug 2011]
Mouse(14125) Fc receptor, IgE, high affinity I, alpha polypeptide
Rat(25047) Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
domestic cat(101094323) Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
Horse(100057308) Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
cow(506783) Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
dog(478970) Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
naked mole-rat(101701190) Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
sheep(100144427) Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002001 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014371 MISSION® esiRNA esiRNA targeting human FCER1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002001 Rosetta Predictions human pricing
NM_012724 Rosetta Predictions rat pricing
NM_010184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134650 predicted 232
2 SASI_Hs01_00134651 predicted 662
3 SASI_Hs01_00134652 predicted 689
4 SASI_Hs01_00134653 predicted 525
5 SASI_Hs01_00134654 predicted 616
6 SASI_Hs01_00134655 predicted 696
7 SASI_Hs01_00134656 predicted 696
8 SASI_Hs01_00134657 predicted 722
9 SASI_Hs01_00134658 predicted 548
10 SASI_Hs02_00333003 predicted 382
11 SASI_Hs01_00134649 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079927 predicted 472
2 SASI_Rn02_00260063 predicted 274
3 SASI_Rn01_00079928 predicted 479
4 SASI_Rn01_00079929 predicted 353
5 SASI_Rn02_00260064 predicted 227
6 SASI_Rn02_00260065 predicted 212
7 SASI_Rn01_00079931 predicted 354
8 SASI_Rn02_00260066 predicted 194
9 SASI_Rn02_00260067 predicted 217
10 SASI_Rn02_00260068 predicted 216
11 SASI_Rn01_00079930 predicted 220
12 SASI_Rn01_00079932 predicted 472
13 SASI_Rn01_00079933 predicted 495
14 SASI_Rn01_00079934 predicted 229
15 SASI_Rn01_00079935 predicted 305
16 SASI_Rn01_00079936 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190364 predicted 580
2 SASI_Mm01_00190365 predicted 655
3 SASI_Mm01_00190366 predicted 756
4 SASI_Mm01_00190367 predicted 321
5 SASI_Mm01_00190368 predicted 621
6 SASI_Mm01_00190369 predicted 397
7 SASI_Mm01_00190371 predicted 347
8 SASI_Mm01_00190372 predicted 270
9 SASI_Mm01_00190373 predicted 468
10 SASI_Mm02_00317972 predicted 463
11 SASI_Mm01_00190370 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002001
FCER1A MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-665s1c1
Sequence:CCGGCCCTCAACATTACTGTAATAACTCGAGTTATTACAGTAATGTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-204s1c1
Sequence:CCGGCCCTCCATGGAATAGAATATTCTCGAGAATATTCTATTCCATGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-573s1c1
Sequence:CCGGCCACAACATCTCCATTACAAACTCGAGTTTGTAATGGAGATGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-385s1c1
Sequence:CCGGCAACAAGTTAATGAGAGTGAACTCGAGTTCACTCTCATTAACTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-783s1c1
Sequence:CCGGGCAGGTCACATTTCTCTTGAACTCGAGTTCAAGAGAAATGTGACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002001.2-517s21c1
Sequence:CCGGGTGTACAAGGTGATCTATTATCTCGAGATAATAGATCACCTTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002001.2-247s21c1
Sequence:CCGGACATGTAATGGGAACAATTTCCTCGAGGAAATTGTTCCCATTACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002001.2-1016s21c1
Sequence:CCGGACTGGTTAAGTGGCATGTAATCTCGAGATTACATGCCACTTAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002001
FCER1A MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-665s1c1
Sequence:CCGGCCCTCAACATTACTGTAATAACTCGAGTTATTACAGTAATGTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-204s1c1
Sequence:CCGGCCCTCCATGGAATAGAATATTCTCGAGAATATTCTATTCCATGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-573s1c1
Sequence:CCGGCCACAACATCTCCATTACAAACTCGAGTTTGTAATGGAGATGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-385s1c1
Sequence:CCGGCAACAAGTTAATGAGAGTGAACTCGAGTTCACTCTCATTAACTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-783s1c1
Sequence:CCGGGCAGGTCACATTTCTCTTGAACTCGAGTTCAAGAGAAATGTGACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002001.2-517s21c1
Sequence:CCGGGTGTACAAGGTGATCTATTATCTCGAGATAATAGATCACCTTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002001.2-247s21c1
Sequence:CCGGACATGTAATGGGAACAATTTCCTCGAGGAAATTGTTCCCATTACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002001.2-1016s21c1
Sequence:CCGGACTGGTTAAGTGGCATGTAATCTCGAGATTACATGCCACTTAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002001
FCER1A MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-665s1c1
Sequence:CCGGCCCTCAACATTACTGTAATAACTCGAGTTATTACAGTAATGTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-204s1c1
Sequence:CCGGCCCTCCATGGAATAGAATATTCTCGAGAATATTCTATTCCATGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-573s1c1
Sequence:CCGGCCACAACATCTCCATTACAAACTCGAGTTTGTAATGGAGATGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-385s1c1
Sequence:CCGGCAACAAGTTAATGAGAGTGAACTCGAGTTCACTCTCATTAACTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002001.2-783s1c1
Sequence:CCGGGCAGGTCACATTTCTCTTGAACTCGAGTTCAAGAGAAATGTGACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002001.2-517s21c1
Sequence:CCGGGTGTACAAGGTGATCTATTATCTCGAGATAATAGATCACCTTGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002001.2-247s21c1
Sequence:CCGGACATGTAATGGGAACAATTTCCTCGAGGAAATTGTTCCCATTACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002001.2-1016s21c1
Sequence:CCGGACTGGTTAAGTGGCATGTAATCTCGAGATTACATGCCACTTAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010184
FCER1A MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010184.1-811s1c1
Sequence:CCGGGTCATTGCTGAAGAAGCAATTCTCGAGAATTGCTTCTTCAGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-138s1c1
Sequence:CCGGCCCACCATGGATTAGAATATTCTCGAGAATATTCTAATCCATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-321s1c1
Sequence:CCGGGCAAGGATTGTTTAAGAGTAACTCGAGTTACTCTTAAACAATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-483s1c1
Sequence:CCGGCCATGCTTTCAACTACAGTTACTCGAGTAACTGTAGTTGAAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-391s1c1
Sequence:CCGGGCTGACATGATCTTAGTCCATCTCGAGATGGACTAAGATCATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010184.2-791s21c1
Sequence:CCGGCCGAACTCCTAACCTAGATACCTCGAGGTATCTAGGTTAGGAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010184.2-636s21c1
Sequence:CCGGAGCTTACAAATGCAAGTATTACTCGAGTAATACTTGCATTTGTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010184.2-725s21c1
Sequence:CCGGCAACCGAAGAACAGTTCAAATCTCGAGATTTGAACTGTTCTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010184
FCER1A MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010184.1-811s1c1
Sequence:CCGGGTCATTGCTGAAGAAGCAATTCTCGAGAATTGCTTCTTCAGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-138s1c1
Sequence:CCGGCCCACCATGGATTAGAATATTCTCGAGAATATTCTAATCCATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-321s1c1
Sequence:CCGGGCAAGGATTGTTTAAGAGTAACTCGAGTTACTCTTAAACAATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-483s1c1
Sequence:CCGGCCATGCTTTCAACTACAGTTACTCGAGTAACTGTAGTTGAAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-391s1c1
Sequence:CCGGGCTGACATGATCTTAGTCCATCTCGAGATGGACTAAGATCATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010184.2-791s21c1
Sequence:CCGGCCGAACTCCTAACCTAGATACCTCGAGGTATCTAGGTTAGGAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010184.2-636s21c1
Sequence:CCGGAGCTTACAAATGCAAGTATTACTCGAGTAATACTTGCATTTGTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010184.2-725s21c1
Sequence:CCGGCAACCGAAGAACAGTTCAAATCTCGAGATTTGAACTGTTCTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010184
FCER1A MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010184.1-811s1c1
Sequence:CCGGGTCATTGCTGAAGAAGCAATTCTCGAGAATTGCTTCTTCAGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-138s1c1
Sequence:CCGGCCCACCATGGATTAGAATATTCTCGAGAATATTCTAATCCATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-321s1c1
Sequence:CCGGGCAAGGATTGTTTAAGAGTAACTCGAGTTACTCTTAAACAATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-483s1c1
Sequence:CCGGCCATGCTTTCAACTACAGTTACTCGAGTAACTGTAGTTGAAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010184.1-391s1c1
Sequence:CCGGGCTGACATGATCTTAGTCCATCTCGAGATGGACTAAGATCATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010184.2-791s21c1
Sequence:CCGGCCGAACTCCTAACCTAGATACCTCGAGGTATCTAGGTTAGGAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010184.2-636s21c1
Sequence:CCGGAGCTTACAAATGCAAGTATTACTCGAGTAATACTTGCATTTGTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010184.2-725s21c1
Sequence:CCGGCAACCGAAGAACAGTTCAAATCTCGAGATTTGAACTGTTCTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks