EMAIL THIS PAGE TO A FRIEND

FCER2

Fc fragment of IgE, low affinity II, receptor for (CD23)

Synonyms: BLAST-2 CD23 CD23A CLEC4J FCE2 IGEBF
UniProtKB ID: P06734
Gene ID:
Human(2208) Summary: The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Rat(171075) Fc fragment of IgE, low affinity II, receptor for (CD23)
dog(484998) Fc fragment of IgE, low affinity II, receptor for (CD23)
Horse(100009715) Fc fragment of IgE, low affinity II, receptor for (CD23)
cow(407106) Fc fragment of IgE, low affinity II, receptor for (CD23)
domestic cat(101096291) Fc fragment of IgE, low affinity II, receptor for (CD23)
domestic guinea pig(100715029) Fc fragment of IgE, low affinity II, receptor for (CD23)
naked mole-rat(101704432) Fc fragment of IgE, low affinity II, receptor for (CD23)
sheep(101123372) Fc fragment of IgE, low affinity II, receptor for (CD23)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500053 Anti-CD23 antibody, Rabbit monoclonal clone SP163, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB5500054 Anti-CD23 antibody, Rabbit monoclonal clone SP23, recombinant, expressed in proprietary host, tissue culture supernatant human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB1405799 Anti-FCER2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA008928 Anti-FCER2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1408575 Anti-FCER2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4700732 Monoclonal Anti-CD23 antibody produced in mouse clone EBVCS-5, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunoprecipitation pricing
SAB4700701 Monoclonal Anti-CD23-FITC antibody produced in mouse clone EBVCS-5, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunoprecipitation pricing
SAB4700678 Monoclonal Anti-CD23-PE antibody produced in mouse clone EBVCS-5, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunoprecipitation pricing
WH0002208M3 Monoclonal Anti-FCER2 antibody produced in mouse clone S52, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403808 Monoclonal Anti-FCER2 antibody produced in mouse clone 2A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100595 Monoclonal Anti-FCER2 antibody produced in mouse clone FCER2-A577, culture supernatant human
western blot pricing
SAB1408993 Monoclonal Anti-FCER2 antibody produced in mouse clone S51, ascites fluid, solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002002 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085991 MISSION® esiRNA esiRNA human FCER2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002002 Rosetta Predictions human pricing
NM_001033924 Rosetta Predictions rat pricing
NM_133550 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106338 predicted 491
2 SASI_Hs01_00106339 predicted 459
3 SASI_Hs01_00106340 predicted 641
4 SASI_Hs01_00106341 predicted 462
5 SASI_Hs01_00106342 predicted 685
6 SASI_Hs01_00106343 predicted 843
7 SASI_Hs01_00106344 predicted 1255
8 SASI_Hs01_00106345 predicted 562
9 SASI_Hs01_00106346 predicted 1068
10 SASI_Hs01_00106347 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093193 predicted 1132
2 SASI_Rn02_00203827 predicted 626
3 SASI_Rn01_00093194 predicted 1028
4 SASI_Rn01_00093195 predicted 1176
5 SASI_Rn01_00093196 predicted 684
6 SASI_Rn01_00093197 predicted 840
7 SASI_Rn01_00093198 predicted 1597
8 SASI_Rn01_00093200 predicted 1272
9 SASI_Rn01_00093201 predicted 1206
10 SASI_Rn01_00093202 predicted 1578
11 SASI_Rn01_00093199 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100212 predicted 1077
2 SASI_Rn02_00267737 predicted 559
3 SASI_Rn01_00100213 predicted 963
4 SASI_Rn01_00100214 predicted 1117
5 SASI_Rn01_00100215 predicted 628
6 SASI_Rn01_00100216 predicted 770
7 SASI_Rn01_00100217 predicted 1529
8 SASI_Rn01_00100219 predicted 1207
9 SASI_Rn01_00100220 predicted 1141
10 SASI_Rn01_00100221 predicted 1524
11 SASI_Rn01_00100218 predicted 1501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002002
FCER2 MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgE, low affinity II, receptor for (CD23)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-676s1c1
Sequence:CCGGGTGGATCAATTTCCAACGGAACTCGAGTTCCGTTGGAAATTGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-694s1c1
Sequence:CCGGGAAGTGCTACTACTTCGGCAACTCGAGTTGCCGAAGTAGTAGCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-478s1c1
Sequence:CCGGGAGATTGAAATCTCAGGACTTCTCGAGAAGTCCTGAGATTTCAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-844s1c1
Sequence:CCGGCCTTCGGAACTTGGACCTGAACTCGAGTTCAGGTCCAAGTTCCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-359s1c1
Sequence:CCGGGCCCGGAACGTCTCTCAAGTTCTCGAGAACTTGAGAGACGTTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002002.4-354s21c1
Sequence:CCGGGGACACCACACAGAGTCTAAACTCGAGTTTAGACTCTGTGTGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002002.4-603s21c1
Sequence:CCGGGAGGAACGAAGCTTCAGATTTCTCGAGAAATCTGAAGCTTCGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002002
FCER2 MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgE, low affinity II, receptor for (CD23)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-676s1c1
Sequence:CCGGGTGGATCAATTTCCAACGGAACTCGAGTTCCGTTGGAAATTGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-694s1c1
Sequence:CCGGGAAGTGCTACTACTTCGGCAACTCGAGTTGCCGAAGTAGTAGCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-478s1c1
Sequence:CCGGGAGATTGAAATCTCAGGACTTCTCGAGAAGTCCTGAGATTTCAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-844s1c1
Sequence:CCGGCCTTCGGAACTTGGACCTGAACTCGAGTTCAGGTCCAAGTTCCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-359s1c1
Sequence:CCGGGCCCGGAACGTCTCTCAAGTTCTCGAGAACTTGAGAGACGTTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002002.4-354s21c1
Sequence:CCGGGGACACCACACAGAGTCTAAACTCGAGTTTAGACTCTGTGTGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002002.4-603s21c1
Sequence:CCGGGAGGAACGAAGCTTCAGATTTCTCGAGAAATCTGAAGCTTCGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002002
FCER2 MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgE, low affinity II, receptor for (CD23)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-676s1c1
Sequence:CCGGGTGGATCAATTTCCAACGGAACTCGAGTTCCGTTGGAAATTGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-694s1c1
Sequence:CCGGGAAGTGCTACTACTTCGGCAACTCGAGTTGCCGAAGTAGTAGCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-478s1c1
Sequence:CCGGGAGATTGAAATCTCAGGACTTCTCGAGAAGTCCTGAGATTTCAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-844s1c1
Sequence:CCGGCCTTCGGAACTTGGACCTGAACTCGAGTTCAGGTCCAAGTTCCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002002.3-359s1c1
Sequence:CCGGGCCCGGAACGTCTCTCAAGTTCTCGAGAACTTGAGAGACGTTCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002002.4-354s21c1
Sequence:CCGGGGACACCACACAGAGTCTAAACTCGAGTTTAGACTCTGTGTGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002002.4-603s21c1
Sequence:CCGGGAGGAACGAAGCTTCAGATTTCTCGAGAAATCTGAAGCTTCGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks