EMAIL THIS PAGE TO A FRIEND

FCF1

FCF1 rRNA-processing protein

52 Gene Product Result for
Synonyms: Bka C14orf111 UTP24
UniProtKB ID: Q9Y324, Q86TW8, Q8TBL8
Gene ID:
Mouse(73736) FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)
Rat(299198) FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)
sheep(101107871) FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)
naked mole-rat(101698148) FCF1 rRNA-processing protein
domestic guinea pig(100723102) FCF1 rRNA-processing protein
Zebrafish(550264) FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)
cow(508270) FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)
domestic cat(101095023) FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)
dog(480386) FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)
chicken(423355) FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015962 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015962 Rosetta Predictions human pricing
NM_001044235 Rosetta Predictions rat pricing
NM_028632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104638 predicted 258
2 SASI_Hs01_00104641 predicted 247
3 SASI_Hs01_00104642 predicted 436
4 SASI_Hs01_00104643 predicted 337
5 SASI_Hs02_00348621 predicted 318
6 SASI_Hs02_00348622 predicted 295
7 SASI_Hs02_00348623 predicted 238
8 SASI_Hs02_00348624 predicted 257
9 SASI_Hs02_00348625 predicted 337
10 SASI_Hs02_00348626 predicted 249
11 SASI_Hs01_00104639 predicted 421
12 SASI_Hs01_00104640 predicted 485
13 SASI_Hs01_00104644 predicted 360
14 SASI_Hs01_00104645 predicted 500
15 SASI_Hs01_00104646 predicted 308
16 SASI_Hs01_00104647 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205077 predicted 409
2 SASI_Rn02_00205078 predicted 408
3 SASI_Rn02_00205079 predicted 353
4 SASI_Rn02_00205080 predicted 333
5 SASI_Rn02_00205081 predicted 276
6 SASI_Rn02_00205082 predicted 310
7 SASI_Rn02_00205083 predicted 310
8 SASI_Rn02_00205084 predicted 464
9 SASI_Rn02_00205085 predicted 464
10 SASI_Rn02_00205086 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099208 predicted 354
2 SASI_Mm01_00099209 predicted 316
3 SASI_Mm01_00099211 predicted 428
4 SASI_Mm01_00099210 predicted 354
5 SASI_Mm01_00099212 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028632
FCF1 MISSION shRNA Bacterial Glycerol Stock
FCF1 rRNA-processing protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028632.1-161s1c1
Sequence:CCGGGCATCCTTCCTGCTTGTTCTTCTCGAGAAGAACAAGCAGGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028632.1-369s1c1
Sequence:CCGGGCACTAAGAATCGCTAAGGATCTCGAGATCCTTAGCGATTCTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028632.1-533s1c1
Sequence:CCGGCCCTATCATGTACTTATCTAACTCGAGTTAGATAAGTACATGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028632.1-557s1c1
Sequence:CCGGCAGATACAACATCGAGCGGATCTCGAGATCCGCTCGATGTTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028632.1-172s1c1
Sequence:CCGGGCTTGTTCTTCCAGTATAATACTCGAGTATTATACTGGAAGAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028632.1-169s1c1
Sequence:CCGGCCTGCTTGTTCTTCCAGTATACTCGAGTATACTGGAAGAACAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028632.1-297s1c1
Sequence:CCGGGCCAAGTGTATCCCTTGTATACTCGAGTATACAAGGGATACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028632
FCF1 MISSION shRNA shRNA Plasmid DNA
FCF1 rRNA-processing protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028632.1-161s1c1
Sequence:CCGGGCATCCTTCCTGCTTGTTCTTCTCGAGAAGAACAAGCAGGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028632.1-369s1c1
Sequence:CCGGGCACTAAGAATCGCTAAGGATCTCGAGATCCTTAGCGATTCTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028632.1-533s1c1
Sequence:CCGGCCCTATCATGTACTTATCTAACTCGAGTTAGATAAGTACATGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028632.1-557s1c1
Sequence:CCGGCAGATACAACATCGAGCGGATCTCGAGATCCGCTCGATGTTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028632.1-172s1c1
Sequence:CCGGGCTTGTTCTTCCAGTATAATACTCGAGTATTATACTGGAAGAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028632.1-169s1c1
Sequence:CCGGCCTGCTTGTTCTTCCAGTATACTCGAGTATACTGGAAGAACAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028632.1-297s1c1
Sequence:CCGGGCCAAGTGTATCCCTTGTATACTCGAGTATACAAGGGATACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028632
FCF1 MISSION shRNA Lentiviral Transduction Particles
FCF1 rRNA-processing protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028632.1-161s1c1
Sequence:CCGGGCATCCTTCCTGCTTGTTCTTCTCGAGAAGAACAAGCAGGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028632.1-369s1c1
Sequence:CCGGGCACTAAGAATCGCTAAGGATCTCGAGATCCTTAGCGATTCTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028632.1-533s1c1
Sequence:CCGGCCCTATCATGTACTTATCTAACTCGAGTTAGATAAGTACATGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028632.1-557s1c1
Sequence:CCGGCAGATACAACATCGAGCGGATCTCGAGATCCGCTCGATGTTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028632.1-172s1c1
Sequence:CCGGGCTTGTTCTTCCAGTATAATACTCGAGTATTATACTGGAAGAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028632.1-169s1c1
Sequence:CCGGCCTGCTTGTTCTTCCAGTATACTCGAGTATACTGGAAGAACAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028632.1-297s1c1
Sequence:CCGGGCCAAGTGTATCCCTTGTATACTCGAGTATACAAGGGATACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015962
VALIDATED
FCF1 MISSION shRNA Bacterial Glycerol Stock
FCF1 rRNA-processing protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015962.4-107s21c1
Sequence:CCGGTCAGAGATCAGAGGCTTAAAGCTCGAGCTTTAAGCCTCTGATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-936s21c1
Sequence:GTACCGGGAGACATGCATTACATCATTTCTCGAGAAATGATGTAATGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-161s21c1
Sequence:CCGGAGAAGGATCCCAGCGCATTAACTCGAGTTAATGCGCTGGGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-257s21c1
Sequence:CCGGTCCTCGTTGATACCAACTTTACTCGAGTAAAGTTGGTATCAACGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-427s21c1
Sequence:CCGGGATCCAAGATTTGAACGATTACTCGAGTAATCGTTCAAATCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015962
VALIDATED
FCF1 MISSION shRNA shRNA Plasmid DNA
FCF1 rRNA-processing protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015962.4-107s21c1
Sequence:CCGGTCAGAGATCAGAGGCTTAAAGCTCGAGCTTTAAGCCTCTGATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-936s21c1
Sequence:GTACCGGGAGACATGCATTACATCATTTCTCGAGAAATGATGTAATGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-161s21c1
Sequence:CCGGAGAAGGATCCCAGCGCATTAACTCGAGTTAATGCGCTGGGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-257s21c1
Sequence:CCGGTCCTCGTTGATACCAACTTTACTCGAGTAAAGTTGGTATCAACGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-427s21c1
Sequence:CCGGGATCCAAGATTTGAACGATTACTCGAGTAATCGTTCAAATCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015962
VALIDATED
FCF1 MISSION shRNA Lentiviral Transduction Particles
FCF1 rRNA-processing protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015962.4-107s21c1
Sequence:CCGGTCAGAGATCAGAGGCTTAAAGCTCGAGCTTTAAGCCTCTGATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-936s21c1
Sequence:GTACCGGGAGACATGCATTACATCATTTCTCGAGAAATGATGTAATGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-161s21c1
Sequence:CCGGAGAAGGATCCCAGCGCATTAACTCGAGTTAATGCGCTGGGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-257s21c1
Sequence:CCGGTCCTCGTTGATACCAACTTTACTCGAGTAAAGTTGGTATCAACGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015962.4-427s21c1
Sequence:CCGGGATCCAAGATTTGAACGATTACTCGAGTAATCGTTCAAATCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks