EMAIL THIS PAGE TO A FRIEND

FCGBP

Fc fragment of IgG binding protein

33 Gene Product Result for
Synonyms: FC(GAMMA)BP
UniProtKB ID: Q9Y6R7, O95784
Gene ID:
Mouse(215384) Fc fragment of IgG binding protein
Rat(100303643) Fc fragment of IgG binding protein
chicken(424904) Fc fragment of IgG binding protein
domestic cat(101090476) Fc fragment of IgG binding protein
dog(484505) Fc fragment of IgG binding protein
cow(534348) Fc fragment of IgG binding protein
domestic guinea pig(100716030) Fc fragment of IgG binding protein
naked mole-rat(101717107) Fc fragment of IgG binding protein
sheep(101118213) Fc fragment of IgG binding protein
Domestic Rabbit(100343867) Fc fragment of IgG binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003890 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001122603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001122603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001122603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138971 MISSION® esiRNA esiRNA human FCGBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003890 Rosetta Predictions human pricing
NM_001122603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170213 predicted 15220
2 SASI_Hs01_00170214 predicted 2612
3 SASI_Hs01_00170215 predicted 586
4 SASI_Hs01_00170217 predicted 784
5 SASI_Hs01_00170219 predicted 1038
6 SASI_Hs01_00170220 predicted 15545
7 SASI_Hs01_00170221 predicted 549
8 SASI_Hs01_00170222 predicted 11968
9 SASI_Hs02_00336505 predicted 5984
10 SASI_Hs01_00170216 predicted 1102
11 SASI_Hs01_00170218 predicted 3199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309057 predicted 6425
2 SASI_Mm02_00309058 predicted 1683
3 SASI_Mm02_00309059 predicted 2865
4 SASI_Mm02_00309060 predicted 1918
5 SASI_Mm02_00309061 predicted 4601
6 SASI_Mm02_00309062 predicted 5003
7 SASI_Mm02_00309063 predicted 5688
8 SASI_Mm02_00309064 predicted 2548
9 SASI_Mm02_00309065 predicted 2174
10 SASI_Mm02_00309066 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003890
FCGBP MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG binding protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003890.2-1833s21c1
Sequence:CCGGGGGCTGTGTGGCAACTATAATCTCGAGATTATAGTTGCCACACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-8058s1c1
Sequence:CCGGCCCTTGAAAGATTGCATCTTTCTCGAGAAAGATGCAATCTTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-465s1c1
Sequence:CCGGGCCAGGAATGTCAAGGAGTTTCTCGAGAAACTCCTTGACATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-781s1c1
Sequence:CCGGCCTCCCAATCTCGCTATGATTCTCGAGAATCATAGCGAGATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-879s1c1
Sequence:CCGGGCAGGTGATGTGGTAGAGTTTCTCGAGAAACTCTACCACATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-12295s1c1
Sequence:CCGGCCTGTAACTATGTGCTGGCAACTCGAGTTGCCAGCACATAGTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003890
FCGBP MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG binding protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003890.2-1833s21c1
Sequence:CCGGGGGCTGTGTGGCAACTATAATCTCGAGATTATAGTTGCCACACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-8058s1c1
Sequence:CCGGCCCTTGAAAGATTGCATCTTTCTCGAGAAAGATGCAATCTTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-465s1c1
Sequence:CCGGGCCAGGAATGTCAAGGAGTTTCTCGAGAAACTCCTTGACATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-781s1c1
Sequence:CCGGCCTCCCAATCTCGCTATGATTCTCGAGAATCATAGCGAGATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-879s1c1
Sequence:CCGGGCAGGTGATGTGGTAGAGTTTCTCGAGAAACTCTACCACATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-12295s1c1
Sequence:CCGGCCTGTAACTATGTGCTGGCAACTCGAGTTGCCAGCACATAGTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003890
FCGBP MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG binding protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003890.2-1833s21c1
Sequence:CCGGGGGCTGTGTGGCAACTATAATCTCGAGATTATAGTTGCCACACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-8058s1c1
Sequence:CCGGCCCTTGAAAGATTGCATCTTTCTCGAGAAAGATGCAATCTTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-465s1c1
Sequence:CCGGGCCAGGAATGTCAAGGAGTTTCTCGAGAAACTCCTTGACATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-781s1c1
Sequence:CCGGCCTCCCAATCTCGCTATGATTCTCGAGAATCATAGCGAGATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-879s1c1
Sequence:CCGGGCAGGTGATGTGGTAGAGTTTCTCGAGAAACTCTACCACATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003890.1-12295s1c1
Sequence:CCGGCCTGTAACTATGTGCTGGCAACTCGAGTTGCCAGCACATAGTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001122603
FCGBP MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-7080s21c1
Sequence:CCGGGTGTCCATAACGGCCAATATACTCGAGTATATTGGCCGTTATGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-3972s21c1
Sequence:CCGGCCACTCTCAACACCAACATTTCTCGAGAAATGTTGGTGTTGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-2838s21c1
Sequence:CCGGTCGTGATTGAAACCGACTTTGCTCGAGCAAAGTCGGTTTCAATCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-1677s21c1
Sequence:CCGGCTATCGTGAGCATAGACTTTGCTCGAGCAAAGTCTATGCTCACGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122603.1-7782s21c1
Sequence:CCGGCTGGCACTGAAGGCATCAAGACTCGAGTCTTGATGCCTTCAGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001122603
FCGBP MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-7080s21c1
Sequence:CCGGGTGTCCATAACGGCCAATATACTCGAGTATATTGGCCGTTATGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-3972s21c1
Sequence:CCGGCCACTCTCAACACCAACATTTCTCGAGAAATGTTGGTGTTGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-2838s21c1
Sequence:CCGGTCGTGATTGAAACCGACTTTGCTCGAGCAAAGTCGGTTTCAATCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-1677s21c1
Sequence:CCGGCTATCGTGAGCATAGACTTTGCTCGAGCAAAGTCTATGCTCACGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122603.1-7782s21c1
Sequence:CCGGCTGGCACTGAAGGCATCAAGACTCGAGTCTTGATGCCTTCAGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001122603
FCGBP MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-7080s21c1
Sequence:CCGGGTGTCCATAACGGCCAATATACTCGAGTATATTGGCCGTTATGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-3972s21c1
Sequence:CCGGCCACTCTCAACACCAACATTTCTCGAGAAATGTTGGTGTTGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-2838s21c1
Sequence:CCGGTCGTGATTGAAACCGACTTTGCTCGAGCAAAGTCGGTTTCAATCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122603.1-1677s21c1
Sequence:CCGGCTATCGTGAGCATAGACTTTGCTCGAGCAAAGTCTATGCTCACGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122603.1-7782s21c1
Sequence:CCGGCTGGCACTGAAGGCATCAAGACTCGAGTCTTGATGCCTTCAGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks