EMAIL THIS PAGE TO A FRIEND

FCGR1A

Fc fragment of IgG, high affinity Ia, receptor (CD64)

96 Gene Product Result for
Synonyms: CD64 CD64A FCRI IGFR1
UniProtKB ID: P12314, P12315, Q5QNW7, Q92495, Q92663
Gene ID:
Human(2209) Summary: This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]
Rat(295279) Fc fragment of IgG, high affinity Ia, receptor (CD64)
sheep(100192431) Fc fragment of IgG, high affinity Ia, receptor (CD64)
cow(282227) Fc fragment of IgG, high affinity Ia, receptor (CD64)
dog(403462) Fc fragment of IgG, high affinity Ia, receptor (CD64)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000566 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000566 Rosetta Predictions human pricing
NM_001100836 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224464 predicted 1037
2 SASI_Hs01_00224466 predicted 1024
3 SASI_Hs02_00302811 predicted 416
4 SASI_Hs01_00224463 predicted 1081
5 SASI_Hs01_00224465 predicted 964
6 SASI_Hs01_00224467 predicted 1091
7 SASI_Hs01_00224469 predicted 704
8 SASI_Hs01_00224470 predicted 425
9 SASI_Hs01_00224471 predicted 959
10 SASI_Hs01_00224472 predicted 572
11 SASI_Hs01_00224468 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210672 predicted 266
2 SASI_Rn02_00210673 predicted 230
3 SASI_Rn02_00210674 predicted 829
4 SASI_Rn02_00210675 predicted 763
5 SASI_Rn02_00210676 predicted 673
6 SASI_Rn02_00210677 predicted 564
7 SASI_Rn02_00210678 predicted 892
8 SASI_Rn02_00210679 predicted 859
9 SASI_Rn02_00210680 predicted 544
10 SASI_Rn02_00210681 predicted 1024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000566
FCGR1A MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, high affinity Ia, receptor (CD64)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-681s1c1
Sequence:CCGGGCAGCTTTACTTCTCCTTCTACTCGAGTAGAAGGAGAAGTAAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-536s1c1
Sequence:CCGGGCTACACATCAGCAGGAATATCTCGAGATATTCCTGCTGATGTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-868s1c1
Sequence:CCGGCCAACTCCTGTCTGGTTTCATCTCGAGATGAAACCAGACAGGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-417s1c1
Sequence:CCGGGCTTTACTATCGAAATGGCAACTCGAGTTGCCATTTCGATAGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-114s1c1
Sequence:CCGGCCAAGAGGAAACCGTAACCTTCTCGAGAAGGTTACGGTTTCCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000566.3-589s21c1
Sequence:CCGGGAATATCTGTCACTGTGAAAGCTCGAGCTTTCACAGTGACAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000566.3-1017s21c1
Sequence:CCGGTGGGATTTAGAAATCTCTTTGCTCGAGCAAAGAGATTTCTAAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000566
FCGR1A MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, high affinity Ia, receptor (CD64)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-681s1c1
Sequence:CCGGGCAGCTTTACTTCTCCTTCTACTCGAGTAGAAGGAGAAGTAAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-536s1c1
Sequence:CCGGGCTACACATCAGCAGGAATATCTCGAGATATTCCTGCTGATGTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-868s1c1
Sequence:CCGGCCAACTCCTGTCTGGTTTCATCTCGAGATGAAACCAGACAGGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-417s1c1
Sequence:CCGGGCTTTACTATCGAAATGGCAACTCGAGTTGCCATTTCGATAGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-114s1c1
Sequence:CCGGCCAAGAGGAAACCGTAACCTTCTCGAGAAGGTTACGGTTTCCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000566.3-589s21c1
Sequence:CCGGGAATATCTGTCACTGTGAAAGCTCGAGCTTTCACAGTGACAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000566.3-1017s21c1
Sequence:CCGGTGGGATTTAGAAATCTCTTTGCTCGAGCAAAGAGATTTCTAAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000566
FCGR1A MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, high affinity Ia, receptor (CD64)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-681s1c1
Sequence:CCGGGCAGCTTTACTTCTCCTTCTACTCGAGTAGAAGGAGAAGTAAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-536s1c1
Sequence:CCGGGCTACACATCAGCAGGAATATCTCGAGATATTCCTGCTGATGTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-868s1c1
Sequence:CCGGCCAACTCCTGTCTGGTTTCATCTCGAGATGAAACCAGACAGGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-417s1c1
Sequence:CCGGGCTTTACTATCGAAATGGCAACTCGAGTTGCCATTTCGATAGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000566.2-114s1c1
Sequence:CCGGCCAAGAGGAAACCGTAACCTTCTCGAGAAGGTTACGGTTTCCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000566.3-589s21c1
Sequence:CCGGGAATATCTGTCACTGTGAAAGCTCGAGCTTTCACAGTGACAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000566.3-1017s21c1
Sequence:CCGGTGGGATTTAGAAATCTCTTTGCTCGAGCAAAGAGATTTCTAAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks