EMAIL THIS PAGE TO A FRIEND

FCGR1C

Fc fragment of IgG, high affinity Ic, receptor (CD64), pseudogene

3 Gene Product Result for
Synonyms: CD64c FCRIC IGFR1 IGFRC
Species: Human FCGR1C(100132417)
UniProtKB ID: A6NKC4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128589 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105281 MISSION® esiRNA esiRNA human FCGR1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128589
FCGR1C MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, high affinity Ic, receptor (CD64), pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-265s21c1
Sequence:CCGGTCACCTCTGCCAGTGTCAATGCTCGAGCATTGACACTGGCAGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-581s21c1
Sequence:CCGGATCAGCAGGAATATCACAATACTCGAGTATTGTGATATTCCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-433s21c1
Sequence:CCGGAGGATAAGCTGGTGTACAATGCTCGAGCATTGTACACCAGCTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-464s21c1
Sequence:CCGGTCGAAATGGCAAAGCCTTTAACTCGAGTTAAAGGCTTTGCCATTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128589.1-1047s21c1
Sequence:CCGGGTCATGAGAAGAAGGTAATTTCTCGAGAAATTACCTTCTTCTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128589
FCGR1C MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, high affinity Ic, receptor (CD64), pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-265s21c1
Sequence:CCGGTCACCTCTGCCAGTGTCAATGCTCGAGCATTGACACTGGCAGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-581s21c1
Sequence:CCGGATCAGCAGGAATATCACAATACTCGAGTATTGTGATATTCCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-433s21c1
Sequence:CCGGAGGATAAGCTGGTGTACAATGCTCGAGCATTGTACACCAGCTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-464s21c1
Sequence:CCGGTCGAAATGGCAAAGCCTTTAACTCGAGTTAAAGGCTTTGCCATTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128589.1-1047s21c1
Sequence:CCGGGTCATGAGAAGAAGGTAATTTCTCGAGAAATTACCTTCTTCTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128589
FCGR1C MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, high affinity Ic, receptor (CD64), pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-265s21c1
Sequence:CCGGTCACCTCTGCCAGTGTCAATGCTCGAGCATTGACACTGGCAGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-581s21c1
Sequence:CCGGATCAGCAGGAATATCACAATACTCGAGTATTGTGATATTCCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-433s21c1
Sequence:CCGGAGGATAAGCTGGTGTACAATGCTCGAGCATTGTACACCAGCTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128589.1-464s21c1
Sequence:CCGGTCGAAATGGCAAAGCCTTTAACTCGAGTTAAAGGCTTTGCCATTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128589.1-1047s21c1
Sequence:CCGGGTCATGAGAAGAAGGTAATTTCTCGAGAAATTACCTTCTTCTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks