EMAIL THIS PAGE TO A FRIEND

FCGR2A

Fc fragment of IgG, low affinity IIa, receptor (CD32)

124 Gene Product Result for
Synonyms: CD32 CD32A CDw32 FCG2 FCGR2 FCGR2A1 FcGR IGFR2
UniProtKB ID: P12318, Q8WUN1, Q8WW64
Gene ID:
Human(2212) Summary: This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
Rat(116591) Fc fragment of IgG, low affinity IIa, receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021642 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144531 MISSION® esiRNA esiRNA human FCGR2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021642 Rosetta Predictions human pricing
NM_053843 Rosetta Predictions rat pricing
XM_001077008 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235799 predicted 818
2 SASI_Hs01_00235803 predicted 783
3 SASI_Hs02_00355003 predicted 377
4 SASI_Hs02_00355004 predicted 761
5 SASI_Hs02_00355005 predicted 708
6 SASI_Hs02_00355006 predicted 514
7 SASI_Hs02_00355007 predicted 822
8 SASI_Hs01_00235800 predicted 792
9 SASI_Hs02_00355008 predicted 995
10 SASI_Hs02_00355009 predicted 964
11 SASI_Hs01_00235797 predicted 492
12 SASI_Hs01_00235798 predicted 480
13 SASI_Hs01_00235801 predicted 496
14 SASI_Hs01_00235802 predicted 749
15 SASI_Hs01_00235804 predicted 750
16 SASI_Hs01_00235805 predicted 210
17 SASI_Hs01_00235806 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048944 predicted 335
2 SASI_Rn01_00048946 predicted 620
3 SASI_Rn01_00048949 predicted 1032
4 SASI_Rn01_00048950 predicted 719
5 SASI_Rn01_00048951 predicted 622
6 SASI_Rn01_00048952 predicted 1050
7 SASI_Rn01_00048953 predicted 429
8 SASI_Rn02_00266693 predicted 1132
9 SASI_Rn02_00266694 predicted 615
10 SASI_Rn02_00266695 predicted 578
11 SASI_Rn01_00048945 predicted 948
12 SASI_Rn01_00048947 predicted 690
13 SASI_Rn01_00048948 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355419 predicted 505
2 SASI_Rn02_00355420 predicted 462
3 SASI_Rn02_00355421 predicted 709
4 SASI_Rn02_00355422 predicted 602
5 SASI_Rn02_00355423 predicted 767
6 SASI_Rn02_00355424 predicted 716
7 SASI_Rn02_00355425 predicted 499
8 SASI_Rn02_00355426 predicted 490
9 SASI_Rn02_00355427 predicted 517
10 SASI_Rn02_00355428 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021642
FCGR2A MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, low affinity IIa, receptor (CD32)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021642.3-400s21c1
Sequence:CCGGTGACTGTGCTTTCCGAATGGCCTCGAGGCCATTCGGAAAGCACAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021642.3-97s21c1
Sequence:CCGGACCTGTGGCTGCTTCAACCATCTCGAGATGGTTGAAGCAGCCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021642.3-1441s21c1
Sequence:CCGGCATGAATTGCGCCTCAGATTTCTCGAGAAATCTGAGGCGCAATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-828s1c1
Sequence:CCGGGAAGAAACCAACAATGACTATCTCGAGATAGTCATTGTTGGTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-888s1c1
Sequence:CCGGGCACCTACTGACGATGATAAACTCGAGTTTATCATCGTCAGTAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-807s1c1
Sequence:CCGGGCCATCAGAAAGAGACAACTTCTCGAGAAGTTGTCTCTTTCTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-938s1c1
Sequence:CCGGCCATGTCAACAGTAATAACTACTCGAGTAGTTATTACTGTTGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021642
FCGR2A MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, low affinity IIa, receptor (CD32)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021642.3-400s21c1
Sequence:CCGGTGACTGTGCTTTCCGAATGGCCTCGAGGCCATTCGGAAAGCACAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021642.3-97s21c1
Sequence:CCGGACCTGTGGCTGCTTCAACCATCTCGAGATGGTTGAAGCAGCCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021642.3-1441s21c1
Sequence:CCGGCATGAATTGCGCCTCAGATTTCTCGAGAAATCTGAGGCGCAATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-828s1c1
Sequence:CCGGGAAGAAACCAACAATGACTATCTCGAGATAGTCATTGTTGGTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-888s1c1
Sequence:CCGGGCACCTACTGACGATGATAAACTCGAGTTTATCATCGTCAGTAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-807s1c1
Sequence:CCGGGCCATCAGAAAGAGACAACTTCTCGAGAAGTTGTCTCTTTCTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-938s1c1
Sequence:CCGGCCATGTCAACAGTAATAACTACTCGAGTAGTTATTACTGTTGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021642
FCGR2A MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, low affinity IIa, receptor (CD32)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021642.3-400s21c1
Sequence:CCGGTGACTGTGCTTTCCGAATGGCCTCGAGGCCATTCGGAAAGCACAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021642.3-97s21c1
Sequence:CCGGACCTGTGGCTGCTTCAACCATCTCGAGATGGTTGAAGCAGCCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021642.3-1441s21c1
Sequence:CCGGCATGAATTGCGCCTCAGATTTCTCGAGAAATCTGAGGCGCAATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-828s1c1
Sequence:CCGGGAAGAAACCAACAATGACTATCTCGAGATAGTCATTGTTGGTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-888s1c1
Sequence:CCGGGCACCTACTGACGATGATAAACTCGAGTTTATCATCGTCAGTAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-807s1c1
Sequence:CCGGGCCATCAGAAAGAGACAACTTCTCGAGAAGTTGTCTCTTTCTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021642.1-938s1c1
Sequence:CCGGCCATGTCAACAGTAATAACTACTCGAGTAGTTATTACTGTTGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks