EMAIL THIS PAGE TO A FRIEND

FCGR2B

Fc fragment of IgG, low affinity IIb, receptor (CD32)

184 Gene Product Result for
Synonyms: CD32 CD32B FCG2 FCGR2 IGFR2
UniProtKB ID: P31994, A6H8N3, O95649, Q53X85, Q5VXA9, Q8NIA1
Gene ID:
Human(2213) Summary: The protein encoded by this gene is a low affinity receptor for the Fc region of immunoglobulin gamma complexes. The encoded protein is involved in the phagocytosis of immune complexes and in the regulation of antibody production by B-cells. Variations in this gene may increase susceptibilty to systemic lupus erythematosus (SLE). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(14130) Fc receptor, IgG, low affinity IIb
Rat(289211) Fc fragment of IgG, low affinity IIb, receptor (CD32)
sheep(100192432) Fc fragment of IgG, low affinity IIb, receptor (CD32)
domestic cat(101087550) Fc fragment of IgG, low affinity IIb, receptor (CD32)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500869 Anti-CD32, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB2500218 Anti-CD32/FCGR2B antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
F9681 Anti-FCGR2B (271-285) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405802 Anti-FCGR2B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA014730 Anti-FCGR2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410376 Anti-FCGR2B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4504023 Anti-phospho-CD32 (pTyr292) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301244 Anti-phospho-CD32 (pTyr292) antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0002213M1 Monoclonal Anti-FCGR2B antibody produced in mouse clone 2E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403809 Monoclonal Anti-FCGR2B antibody produced in mouse clone 2E10, ascites fluid human
ELISA, western blot pricing
SAB1408994 Monoclonal Anti-FCGR2B antibody produced in mouse clone 1A9, ascites fluid, solution human
ELISA pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0909 AQUA Peptide SQVQASYTF[K] mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004001 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MABF925 Anti-FcγRII (human) Antibody, clone AT10 Anti-FcγRII (human) Antibody, clone AT10 is an antibody against FcγRII for use in Flow Cytometry. pricing
MABF841 Anti-FCGR2A/C Antibody, clone 11B6 Anti-FCGR2A/C Antibody, clone 11B6 is an antibody against FCGR2A/C for use in Immunohistochemistry (Paraffin), Immunocytochemistry, Western Blotting. pricing
MABF838 Anti-FcgRII/III Anibody, clone Ab93 This Anti-FcgRII/III Anibody, clone Ab93 is validated for use in Flow Cytometry, Immunocytochemistry, Activity Assay for the detection of FcgRII/II. pricing
MAB1302 Mouse Anti-Human IgG Antibody, clone HP6017, Fc Detect Human IgG using this Mouse anti-Human IgG Antibody, clone HP6017, Fc validated for use in ELISA, RIA & WB. pricing
MAB1307 Mouse Anti-Human IgG1 Antibody, clone HP6001, Fc Detect Human IgG1 using this Mouse anti-Human IgG1 Antibody, clone HP6001, Fc validated for use in ELISA, RIA & WB. pricing
MAB1308 Mouse Anti-Human IgG2 Antibody, clone HP6002, Fc This Mouse anti-Human IgG2 Antibody, clone HP6002, Fc is validated for use in ELISA, RIA, WB for the detection of Human IgG2. pricing
MAB1312 Mouse Anti-Human IgG4 Antibody, clone HP6023, Fc Mouse anti-Human IgG4 Antibody, clone HP6023, Fc is an antibody against Human IgG4 for use in ELISA, RIA & WB. pricing
MAB1313 Mouse Anti-Human IgG4 Antibody, clone HP6025, Fc Mouse anti-Human IgG4 Antibody, clone HP6025, Fc detects level of Human IgG4 & has been published & validated for use in ELISA, RIA & WB. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002273 Rosetta Predictions human pricing
NM_001002274 Rosetta Predictions human pricing
NM_001002275 Rosetta Predictions human pricing
NM_004001 Rosetta Predictions human pricing
NM_175756 Rosetta Predictions rat pricing
NM_001077189 Rosetta Predictions mouse pricing
NM_010187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038997 predicted 1045
2 SASI_Hs01_00039003 predicted 607
3 SASI_Hs02_00304158 predicted 456
4 SASI_Hs02_00304159 predicted 1068
5 SASI_Hs02_00304160 predicted 1097
6 SASI_Hs02_00304161 predicted 1105
7 SASI_Hs02_00304162 predicted 1255
8 SASI_Hs02_00304163 predicted 962
9 SASI_Hs02_00304164 predicted 965
10 SASI_Hs02_00304165 predicted 1159
11 SASI_Hs01_00038995 predicted 580
12 SASI_Hs01_00038996 predicted 570
13 SASI_Hs01_00038998 predicted 1124
14 SASI_Hs01_00038999 predicted 461
15 SASI_Hs01_00039000 predicted 524
16 SASI_Hs01_00039001 predicted 530
17 SASI_Hs01_00039002 predicted 1055
18 SASI_Hs01_00039004 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097700 predicted 1053
2 SASI_Hs01_00097706 predicted 609
3 SASI_Hs02_00304166 predicted 467
4 SASI_Hs02_00304167 predicted 1076
5 SASI_Hs02_00304168 predicted 1094
6 SASI_Hs02_00304169 predicted 1104
7 SASI_Hs02_00304170 predicted 1258
8 SASI_Hs02_00304171 predicted 969
9 SASI_Hs02_00304172 predicted 971
10 SASI_Hs02_00304173 predicted 1160
11 SASI_Hs01_00097698 predicted 578
12 SASI_Hs01_00097699 predicted 571
13 SASI_Hs01_00097701 predicted 1121
14 SASI_Hs01_00097702 predicted 463
15 SASI_Hs01_00097703 predicted 531
16 SASI_Hs01_00097704 predicted 537
17 SASI_Hs01_00097705 predicted 1055
18 SASI_Hs01_00097707 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195928 predicted 1109
2 SASI_Hs01_00195934 predicted 610
3 SASI_Hs02_00304174 predicted 462
4 SASI_Hs02_00304175 predicted 1132
5 SASI_Hs02_00304176 predicted 1146
6 SASI_Hs02_00304177 predicted 1158
7 SASI_Hs02_00304178 predicted 834
8 SASI_Hs02_00304179 predicted 990
9 SASI_Hs02_00304180 predicted 1004
10 SASI_Hs02_00304181 predicted 1303
11 SASI_Hs01_00195926 predicted 577
12 SASI_Hs01_00195927 predicted 566
13 SASI_Hs01_00195929 predicted 1178
14 SASI_Hs01_00195930 predicted 457
15 SASI_Hs01_00195931 predicted 521
16 SASI_Hs01_00195932 predicted 533
17 SASI_Hs01_00195933 predicted 1109
18 SASI_Hs01_00195935 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126626 predicted 1107
2 SASI_Hs01_00126632 predicted 618
3 SASI_Hs02_00336724 predicted 461
4 SASI_Hs02_00336725 predicted 1129
5 SASI_Hs02_00336726 predicted 1149
6 SASI_Hs02_00336727 predicted 1165
7 SASI_Hs02_00336728 predicted 835
8 SASI_Hs02_00336729 predicted 997
9 SASI_Hs02_00336730 predicted 1015
10 SASI_Hs02_00336731 predicted 1309
11 SASI_Hs01_00126624 predicted 576
12 SASI_Hs01_00126625 predicted 569
13 SASI_Hs01_00126627 predicted 1181
14 SASI_Hs01_00126628 predicted 460
15 SASI_Hs01_00126629 predicted 522
16 SASI_Hs01_00126630 predicted 530
17 SASI_Hs01_00126631 predicted 1111
18 SASI_Hs01_00126633 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121425 predicted 874
2 SASI_Rn01_00121426 predicted 870
3 SASI_Rn01_00121427 predicted 974
4 SASI_Rn01_00121428 predicted 275
5 SASI_Rn01_00121429 predicted 463
6 SASI_Rn01_00121430 predicted 1033
7 SASI_Rn01_00121432 predicted 765
8 SASI_Rn01_00121433 predicted 283
9 SASI_Rn01_00121434 predicted 129
10 SASI_Rn01_00121431 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292382 predicted 764
2 SASI_Mm02_00292383 predicted 945
3 SASI_Mm02_00292384 predicted 1109
4 SASI_Mm02_00292385 predicted 1078
5 SASI_Mm02_00292386 predicted 1021
6 SASI_Mm02_00292387 predicted 709
7 SASI_Mm02_00292388 predicted 780
8 SASI_Mm02_00292389 predicted 943
9 SASI_Mm02_00292390 predicted 960
10 SASI_Mm02_00292391 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317974 predicted 1099
2 SASI_Mm02_00317975 predicted 1079
3 SASI_Mm02_00317976 predicted 1031
4 SASI_Mm02_00317977 predicted 1096
5 SASI_Mm02_00317978 predicted 1088
6 SASI_Mm02_00317979 predicted 1085
7 SASI_Mm02_00317980 predicted 1062
8 SASI_Mm02_00317981 predicted 1047
9 SASI_Mm02_00317982 predicted 1032
10 SASI_Mm02_00317983 predicted 1085
11 SASI_Mm01_00030389 predicted 738
12 SASI_Mm01_00030390 predicted 938
13 SASI_Mm01_00030391 predicted 904
14 SASI_Mm01_00030392 predicted 847
15 SASI_Mm01_00030393 predicted 678
16 SASI_Mm01_00030394 predicted 751
17 SASI_Mm01_00030395 predicted 786
18 SASI_Mm01_00030396 predicted 746
19 SASI_Mm01_00030397 predicted 740
20 SASI_Mm01_00030398 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004001
FCGR2B MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, low affinity IIb, receptor (CD32)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-971s1c1
Sequence:CCGGTGATGACCAGAACCGTATTTACTCGAGTAAATACGGTTCTGGTCATCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-812s1c1
Sequence:CCGGGATTTCAGCTCTCCCAGGATACTCGAGTATCCTGGGAGAGCTGAAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-159s1c1
Sequence:CCGGCATATGCTTCTGTGGACAGCTCTCGAGAGCTGTCCACAGAAGCATATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-876s1c1
Sequence:CCGGGCCAATCCCACTAATCCTGATCTCGAGATCAGGATTAGTGGGATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-620s1c1
Sequence:CCGGCCACAGTCACAGTGGTGATTACTCGAGTAATCACCACTGTGACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004001.3-1015s21c1
Sequence:CCGGACCGTATTTAGTCTCCATTGTCTCGAGACAATGGAGACTAAATACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004001.3-1353s21c1
Sequence:CCGGACGTGAGAACAATCATGTAAACTCGAGTTTACATGATTGTTCTCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004001.3-956s21c1
Sequence:CCGGCACAATCACCTATTCACTTCTCTCGAGAGAAGTGAATAGGTGATTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004001
FCGR2B MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, low affinity IIb, receptor (CD32)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-971s1c1
Sequence:CCGGTGATGACCAGAACCGTATTTACTCGAGTAAATACGGTTCTGGTCATCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-812s1c1
Sequence:CCGGGATTTCAGCTCTCCCAGGATACTCGAGTATCCTGGGAGAGCTGAAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-159s1c1
Sequence:CCGGCATATGCTTCTGTGGACAGCTCTCGAGAGCTGTCCACAGAAGCATATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-876s1c1
Sequence:CCGGGCCAATCCCACTAATCCTGATCTCGAGATCAGGATTAGTGGGATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-620s1c1
Sequence:CCGGCCACAGTCACAGTGGTGATTACTCGAGTAATCACCACTGTGACTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004001.3-1015s21c1
Sequence:CCGGACCGTATTTAGTCTCCATTGTCTCGAGACAATGGAGACTAAATACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004001.3-1353s21c1
Sequence:CCGGACGTGAGAACAATCATGTAAACTCGAGTTTACATGATTGTTCTCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004001.3-956s21c1
Sequence:CCGGCACAATCACCTATTCACTTCTCTCGAGAGAAGTGAATAGGTGATTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004001
FCGR2B MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, low affinity IIb, receptor (CD32)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-971s1c1
Sequence:CCGGTGATGACCAGAACCGTATTTACTCGAGTAAATACGGTTCTGGTCATCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-812s1c1
Sequence:CCGGGATTTCAGCTCTCCCAGGATACTCGAGTATCCTGGGAGAGCTGAAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-159s1c1
Sequence:CCGGCATATGCTTCTGTGGACAGCTCTCGAGAGCTGTCCACAGAAGCATATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-876s1c1
Sequence:CCGGGCCAATCCCACTAATCCTGATCTCGAGATCAGGATTAGTGGGATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004001.2-620s1c1
Sequence:CCGGCCACAGTCACAGTGGTGATTACTCGAGTAATCACCACTGTGACTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004001.3-1015s21c1
Sequence:CCGGACCGTATTTAGTCTCCATTGTCTCGAGACAATGGAGACTAAATACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004001.3-1353s21c1
Sequence:CCGGACGTGAGAACAATCATGTAAACTCGAGTTTACATGATTGTTCTCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004001.3-956s21c1
Sequence:CCGGCACAATCACCTATTCACTTCTCTCGAGAGAAGTGAATAGGTGATTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010187
FCGR2B MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, low affinity IIb, receptor (CD32)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-733s1c1
Sequence:CCGGGCCATTGTTATTATCCTAGTACTCGAGTACTAGGATAATAACAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-90s1c1
Sequence:CCGGCTCACGGACTTTGTGCCATATCTCGAGATATGGCACAAAGTCCGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-81s1c1
Sequence:CCGGCCATGTGTTCTCACGGACTTTCTCGAGAAAGTCCGTGAGAACACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-674s1c1
Sequence:CCGGCCAGCAGGTCTTTACCAGTATCTCGAGATACTGGTAAAGACCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010187.2-1180s21c1
Sequence:CCGGTAATCAACTTACTGCCGTTAACTCGAGTTAACGGCAGTAAGTTGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010187.2-1011s21c1
Sequence:CCGGAGGGATGCTGTAGATATTAAACTCGAGTTTAATATCTACAGCATCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010187.2-1211s21c1
Sequence:CCGGCAACGTGGGAACTGCTTATAACTCGAGTTATAAGCAGTTCCCACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010187
FCGR2B MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, low affinity IIb, receptor (CD32)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-733s1c1
Sequence:CCGGGCCATTGTTATTATCCTAGTACTCGAGTACTAGGATAATAACAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-90s1c1
Sequence:CCGGCTCACGGACTTTGTGCCATATCTCGAGATATGGCACAAAGTCCGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-81s1c1
Sequence:CCGGCCATGTGTTCTCACGGACTTTCTCGAGAAAGTCCGTGAGAACACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-674s1c1
Sequence:CCGGCCAGCAGGTCTTTACCAGTATCTCGAGATACTGGTAAAGACCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010187.2-1180s21c1
Sequence:CCGGTAATCAACTTACTGCCGTTAACTCGAGTTAACGGCAGTAAGTTGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010187.2-1011s21c1
Sequence:CCGGAGGGATGCTGTAGATATTAAACTCGAGTTTAATATCTACAGCATCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010187.2-1211s21c1
Sequence:CCGGCAACGTGGGAACTGCTTATAACTCGAGTTATAAGCAGTTCCCACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010187
FCGR2B MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, low affinity IIb, receptor (CD32)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-733s1c1
Sequence:CCGGGCCATTGTTATTATCCTAGTACTCGAGTACTAGGATAATAACAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-90s1c1
Sequence:CCGGCTCACGGACTTTGTGCCATATCTCGAGATATGGCACAAAGTCCGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-81s1c1
Sequence:CCGGCCATGTGTTCTCACGGACTTTCTCGAGAAAGTCCGTGAGAACACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010187.1-674s1c1
Sequence:CCGGCCAGCAGGTCTTTACCAGTATCTCGAGATACTGGTAAAGACCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010187.2-1180s21c1
Sequence:CCGGTAATCAACTTACTGCCGTTAACTCGAGTTAACGGCAGTAAGTTGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010187.2-1011s21c1
Sequence:CCGGAGGGATGCTGTAGATATTAAACTCGAGTTTAATATCTACAGCATCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010187.2-1211s21c1
Sequence:CCGGCAACGTGGGAACTGCTTATAACTCGAGTTATAAGCAGTTCCCACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)