EMAIL THIS PAGE TO A FRIEND

FCGR2C

Fc fragment of IgG, low affinity IIc, receptor for (CD32) (gene/pseudogene)

67 Gene Product Result for
Synonyms: CD32 CD32C CDW32 FCG2 FCRIIC IGFR2
UniProtKB ID: P31995, O00523, O00524, O00525
Gene ID:
Human(9103) Summary: This gene encodes one of three members of a family of low-affinity immunoglobulin gamma Fc receptors found on the surface of many immune response cells. The encoded protein is a transmembrane glycoprotein and may be involved in phagocytosis and clearing of immune complexes. An allelic polymorphism in this gene results in both coding and non-coding variants. [provided by RefSeq, Apr 2012]
cow(782652) Fc fragment of IgG, low affinity IIc, receptor for (CD32)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201563 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005410 Rosetta Predictions human pricing
NM_001005411 Rosetta Predictions human pricing
NM_001005412 Rosetta Predictions human pricing
NM_201563 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209933 predicted 378
2 SASI_Hs02_00304895 predicted 257
3 SASI_Hs02_00304896 predicted 336
4 SASI_Hs01_00209935 predicted 450
5 SASI_Hs02_00304897 predicted 274
6 SASI_Hs02_00304898 predicted 514
7 SASI_Hs02_00304899 predicted 567
8 SASI_Hs02_00304900 predicted 304
9 SASI_Hs01_00209939 predicted 609
10 SASI_Hs02_00304901 predicted 268
11 SASI_Hs01_00209930 predicted 561
12 SASI_Hs01_00209931 predicted 569
13 SASI_Hs01_00209932 predicted 496
14 SASI_Hs01_00209934 predicted 474
15 SASI_Hs01_00209936 predicted 446
16 SASI_Hs01_00209937 predicted 583
17 SASI_Hs01_00209938 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142318 predicted 373
2 SASI_Hs02_00304902 predicted 256
3 SASI_Hs02_00304903 predicted 341
4 SASI_Hs02_00304904 predicted 453
5 SASI_Hs02_00304905 predicted 267
6 SASI_Hs02_00304906 predicted 514
7 SASI_Hs02_00304907 predicted 573
8 SASI_Hs01_00142324 predicted 305
9 SASI_Hs02_00304908 predicted 613
10 SASI_Hs02_00304909 predicted 268
11 SASI_Hs01_00142315 predicted 566
12 SASI_Hs01_00142316 predicted 631
13 SASI_Hs01_00142317 predicted 479
14 SASI_Hs01_00142319 predicted 495
15 SASI_Hs01_00142320 predicted 444
16 SASI_Hs01_00142321 predicted 577
17 SASI_Hs01_00142322 predicted 601
18 SASI_Hs01_00142323 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187596 predicted 572
2 SASI_Hs01_00187597 predicted 441
3 SASI_Hs01_00187598 predicted 489
4 SASI_Hs01_00187599 predicted 296
5 SASI_Hs01_00187600 predicted 483
6 SASI_Hs01_00187601 predicted 632
7 SASI_Hs01_00187602 predicted 581
8 SASI_Hs01_00187603 predicted 656
9 SASI_Hs01_00187604 predicted 602
10 SASI_Hs01_00187605 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041951 predicted 609
2 SASI_Hs02_00373053 predicted 457
3 SASI_Hs02_00373054 predicted 119
4 SASI_Hs02_00373055 predicted 191
5 SASI_Hs01_00041942 predicted 567
6 SASI_Hs01_00041943 predicted 565
7 SASI_Hs01_00041944 predicted 495
8 SASI_Hs01_00041945 predicted 300
9 SASI_Hs01_00041946 predicted 480
10 SASI_Hs01_00041947 predicted 376
11 SASI_Hs01_00041948 predicted 444
12 SASI_Hs01_00041949 predicted 574
13 SASI_Hs01_00041950 predicted 252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201563
FCGR2C MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, low affinity IIc, receptor for (CD32) (gene/pseudogene)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000029584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-796s1c1
Sequence:CCGGGCCTTGATCTACTGCAGGAAACTCGAGTTTCCTGCAGTAGATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-316s1c1
Sequence:CCGGCAGTGGTTCCACAATGGGAATCTCGAGATTCCCATTGTGGAACCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-868s1c1
Sequence:CCGGGCTGAGAACACAATCACCTATCTCGAGATAGGTGATTGTGTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-922s1c1
Sequence:CCGGCCTGATGACCAGAACCGTATTCTCGAGAATACGGTTCTGGTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201563
FCGR2C MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, low affinity IIc, receptor for (CD32) (gene/pseudogene)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000029584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-796s1c1
Sequence:CCGGGCCTTGATCTACTGCAGGAAACTCGAGTTTCCTGCAGTAGATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-316s1c1
Sequence:CCGGCAGTGGTTCCACAATGGGAATCTCGAGATTCCCATTGTGGAACCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-868s1c1
Sequence:CCGGGCTGAGAACACAATCACCTATCTCGAGATAGGTGATTGTGTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-922s1c1
Sequence:CCGGCCTGATGACCAGAACCGTATTCTCGAGAATACGGTTCTGGTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201563
FCGR2C MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, low affinity IIc, receptor for (CD32) (gene/pseudogene)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000029584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-796s1c1
Sequence:CCGGGCCTTGATCTACTGCAGGAAACTCGAGTTTCCTGCAGTAGATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-316s1c1
Sequence:CCGGCAGTGGTTCCACAATGGGAATCTCGAGATTCCCATTGTGGAACCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-868s1c1
Sequence:CCGGGCTGAGAACACAATCACCTATCTCGAGATAGGTGATTGTGTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201563.1-922s1c1
Sequence:CCGGCCTGATGACCAGAACCGTATTCTCGAGAATACGGTTCTGGTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks