EMAIL THIS PAGE TO A FRIEND

FCGR3A

Fc fragment of IgG, low affinity IIIa, receptor (CD16a)

75 Gene Product Result for
Synonyms: CD16 CD16A FCG3 FCGR3 FCGRIII FCR-10 FCRIII FCRIIIA IGFR3
Gene ID:
Human(2214) Summary: This gene encodes a receptor for the Fc portion of immunoglobulin G, and it is involved in the removal of antigen-antibody complexes from the circulation, as well as other other antibody-dependent responses. This gene (FCGR3A) is highly similar to another nearby gene (FCGR3B) located on chromosome 1. The receptor encoded by this gene is expressed on natural killer (NK) cells as an integral membrane glycoprotein anchored through a transmembrane peptide, whereas FCGR3B is expressed on polymorphonuclear neutrophils (PMN) where the receptor is anchored through a phosphatidylinositol (PI) linkage. Mutations in this gene have been linked to susceptibility to recurrent viral infections, susceptibility to systemic lupus erythematosus, and alloimmune neonatal neutropenia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(304966) Fc fragment of IgG, low affinity IIIa, receptor
sheep(100192433) Fc fragment of IgG, low affinity IIIa, receptor (CD16a)
dog(478984) Fc fragment of IgG, low affinity IIIa, receptor (CD16a)
cow(281766) Fc fragment of IgG, low affinity IIIa, receptor (CD16a)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500045 Anti-CD16A antibody, Rabbit monoclonal clone SP175, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB5500046 Anti-CD16A antibody, Rabbit monoclonal clone SP189, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
HPA055431 Anti-FCGR3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4700268 Monoclonal Anti-CD16 antibody produced in mouse clone MEM-168, purified immunoglobulin, buffered aqueous solution nonhuman primates, pig, human
flow cytometry pricing
SAB4700269 Monoclonal Anti-CD16 antibody produced in mouse clone LNK16, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700274 Monoclonal Anti-CD16 antibody produced in mouse clone 3G8, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700276 Monoclonal Anti-CD16 antibody produced in mouse clone MEM-154, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700275 Monoclonal Anti-CD16 azide free antibody produced in mouse clone MEM-154, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700722 Monoclonal Anti-CD16-APC antibody produced in mouse clone 3G8, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry, FUNC, immunohistochemistry, immunoprecipitation pricing
SAB4700271 Monoclonal Anti-CD16-Biotin antibody produced in mouse clone 3G8, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700277 Monoclonal Anti-CD16-Biotin antibody produced in mouse clone MEM-154, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
F3668 Monoclonal Anti-CD16−FITC antibody produced in mouse clone 3G8, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700272 Monoclonal Anti-CD16-FITC antibody produced in mouse clone LNK16, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700278 Monoclonal Anti-CD16-FITC antibody produced in mouse clone MEM-154, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700709 Monoclonal Anti-CD16-FITC antibody produced in mouse clone 3G8, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry, FUNC, immunohistochemistry, immunoprecipitation pricing
SAB4700273 Monoclonal Anti-CD16-PE antibody produced in mouse clone LNK16, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700279 Monoclonal Anti-CD16-PE antibody produced in mouse clone MEM-154, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700689 Monoclonal Anti-CD16-PE antibody produced in mouse clone 3G8, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry, FUNC, immunohistochemistry, immunoprecipitation pricing
SAB1403810 Monoclonal Anti-FCGR3A, (C-terminal) antibody produced in mouse clone 2B11, ascites fluid human
ELISA, western blot pricing
SAB1402191 Monoclonal Anti-FCGR3A, (C-terminal) antibody produced in mouse clone 2B11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0908 AQUA Peptide ATVDDSGEY[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000569 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110711 MISSION® esiRNA esiRNA human FCGR3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000569 Rosetta Predictions human pricing
NM_001127592 Rosetta Predictions human pricing
NM_001127593 Rosetta Predictions human pricing
NM_001127595 Rosetta Predictions human pricing
NM_001127596 Rosetta Predictions human pricing
NM_207603 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302814 predicted 1181
2 SASI_Hs02_00302815 predicted 1178
3 SASI_Hs01_00038418 predicted 964
4 SASI_Hs01_00038419 predicted 552
5 SASI_Hs01_00038420 predicted 683
6 SASI_Hs01_00038421 predicted 984
7 SASI_Hs01_00038422 predicted 245
8 SASI_Hs01_00038423 predicted 1104
9 SASI_Hs01_00038424 predicted 902
10 SASI_Hs01_00038425 predicted 875
11 SASI_Hs01_00038426 predicted 919
12 SASI_Hs01_00038427 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329814 predicted 1175
2 SASI_Hs02_00329815 predicted 1172
3 SASI_Hs02_00329816 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329817 predicted 1040
2 SASI_Hs02_00329818 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329819 predicted 1029
2 SASI_Hs02_00329820 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329821 predicted 1017
2 SASI_Hs02_00329822 predicted 1020
3 SASI_Hs02_00329823 predicted 189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270428 predicted 512
2 SASI_Rn01_00116949 predicted 542
3 SASI_Rn01_00116950 predicted 460
4 SASI_Rn01_00116951 predicted 473
5 SASI_Rn01_00116952 predicted 347
6 SASI_Rn01_00116953 predicted 411
7 SASI_Rn01_00116954 predicted 479
8 SASI_Rn01_00116955 predicted 411
9 SASI_Rn01_00116956 predicted 601
10 SASI_Rn01_00116958 predicted 333
11 SASI_Rn01_00116957 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000569
FCGR3A MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, low affinity IIIa, receptor (CD16a)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000569.4-950s1c1
Sequence:CCGGGCAGTGGACACAGGACTATATCTCGAGATATAGTCCTGTGTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-848s1c1
Sequence:CCGGGTGAACATCACCATCACTCAACTCGAGTTGAGTGATGGTGATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-455s1c1
Sequence:CCGGGACAATTCCACACAGTGGTTTCTCGAGAAACCACTGTGTGGAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-695s1c1
Sequence:CCGGGCTCTGCATAAGGTCACATATCTCGAGATATGTGACCTTATGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000569.4-311s1c1
Sequence:CCGGCCAACTGCTCTGCTACTTCTACTCGAGTAGAAGTAGCAGAGCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-211s1c1
Sequence:CCGGGTTTACTTCCTCCTGTCTAGTCTCGAGACTAGACAGGAGGAAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000569.6-1005s21c1
Sequence:CCGGGAGACTGGAAGGACCATAAATCTCGAGATTTATGGTCCTTCCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000569.6-1553s21c1
Sequence:CCGGGGTAGTCCAGGATAGTCTAAGCTCGAGCTTAGACTATCCTGGACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000569.6-951s21c1
Sequence:CCGGCAGTGGACACAGGACTATATTCTCGAGAATATAGTCCTGTGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000569.6-645s21c1
Sequence:CCGGTCAAGGAGGAAGACCCTATTCCTCGAGGAATAGGGTCTTCCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000569
FCGR3A MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, low affinity IIIa, receptor (CD16a)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000569.4-950s1c1
Sequence:CCGGGCAGTGGACACAGGACTATATCTCGAGATATAGTCCTGTGTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-848s1c1
Sequence:CCGGGTGAACATCACCATCACTCAACTCGAGTTGAGTGATGGTGATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-455s1c1
Sequence:CCGGGACAATTCCACACAGTGGTTTCTCGAGAAACCACTGTGTGGAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-695s1c1
Sequence:CCGGGCTCTGCATAAGGTCACATATCTCGAGATATGTGACCTTATGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000569.4-311s1c1
Sequence:CCGGCCAACTGCTCTGCTACTTCTACTCGAGTAGAAGTAGCAGAGCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-211s1c1
Sequence:CCGGGTTTACTTCCTCCTGTCTAGTCTCGAGACTAGACAGGAGGAAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000569.6-1005s21c1
Sequence:CCGGGAGACTGGAAGGACCATAAATCTCGAGATTTATGGTCCTTCCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000569.6-1553s21c1
Sequence:CCGGGGTAGTCCAGGATAGTCTAAGCTCGAGCTTAGACTATCCTGGACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000569.6-951s21c1
Sequence:CCGGCAGTGGACACAGGACTATATTCTCGAGAATATAGTCCTGTGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000569.6-645s21c1
Sequence:CCGGTCAAGGAGGAAGACCCTATTCCTCGAGGAATAGGGTCTTCCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000569
FCGR3A MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, low affinity IIIa, receptor (CD16a)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000569.4-950s1c1
Sequence:CCGGGCAGTGGACACAGGACTATATCTCGAGATATAGTCCTGTGTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-848s1c1
Sequence:CCGGGTGAACATCACCATCACTCAACTCGAGTTGAGTGATGGTGATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-455s1c1
Sequence:CCGGGACAATTCCACACAGTGGTTTCTCGAGAAACCACTGTGTGGAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-695s1c1
Sequence:CCGGGCTCTGCATAAGGTCACATATCTCGAGATATGTGACCTTATGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000569.4-311s1c1
Sequence:CCGGCCAACTGCTCTGCTACTTCTACTCGAGTAGAAGTAGCAGAGCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000569.4-211s1c1
Sequence:CCGGGTTTACTTCCTCCTGTCTAGTCTCGAGACTAGACAGGAGGAAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000569.6-1005s21c1
Sequence:CCGGGAGACTGGAAGGACCATAAATCTCGAGATTTATGGTCCTTCCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000569.6-1553s21c1
Sequence:CCGGGGTAGTCCAGGATAGTCTAAGCTCGAGCTTAGACTATCCTGGACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000569.6-951s21c1
Sequence:CCGGCAGTGGACACAGGACTATATTCTCGAGAATATAGTCCTGTGTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000569.6-645s21c1
Sequence:CCGGTCAAGGAGGAAGACCCTATTCCTCGAGGAATAGGGTCTTCCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks