EMAIL THIS PAGE TO A FRIEND

FCGR3B

Fc fragment of IgG, low affinity IIIb, receptor (CD16b)

29 Gene Product Result for
Synonyms: CD16 CD16b FCG3 FCGR3 FCR-10 FCRIII FCRIIIb
Species: Human FCGR3B(2215)
UniProtKB ID: O75015
Gene ID:
Human(2215) Summary: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1. [provided by RefSeq, Aug 2012]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000570 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000570 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165526 predicted 683
2 SASI_Hs01_00165527 predicted 270
3 SASI_Hs01_00165528 predicted 744
4 SASI_Hs01_00165529 predicted 414
5 SASI_Hs01_00165530 predicted 452
6 SASI_Hs01_00165531 predicted 704
7 SASI_Hs01_00165532 predicted 823
8 SASI_Hs01_00165533 predicted 1005
9 SASI_Hs01_00165534 predicted 893
10 SASI_Hs01_00165535 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000570
FCGR3B MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, low affinity IIIb, receptor (CD16b)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000570.3-706s21c1
Sequence:CCGGTGGCAAAGACAGGAAGTATTTCTCGAGAAATACTTCCTGTCTTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000570.3-987s21c1
Sequence:CCGGGAGACTGGAAGGACCATAAACCTCGAGGTTTATGGTCCTTCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000570.3-732s21c1
Sequence:CCGGATAATTCTGACTTCCACATTCCTCGAGGAATGTGGAAGTCAGAATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-436s1c1
Sequence:CCGGGCTCTGCATAAGGTCACATATCTCGAGATATGTGACCTTATGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-691s1c1
Sequence:CCGGGCAGTGGACACAGGACTATATCTCGAGATATAGTCCTGTGTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-329s1c1
Sequence:CCGGCGGTGCAGCTAGAAGTCCATACTCGAGTATGGACTTCTAGCTGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-594s1c1
Sequence:CCGGCATCACCATCACTCAAGGTTTCTCGAGAAACCTTGAGTGATGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-668s1c1
Sequence:CCGGGCTTGGTGATGGTACTCCTTTCTCGAGAAAGGAGTACCATCACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000570
FCGR3B MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, low affinity IIIb, receptor (CD16b)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000570.3-706s21c1
Sequence:CCGGTGGCAAAGACAGGAAGTATTTCTCGAGAAATACTTCCTGTCTTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000570.3-987s21c1
Sequence:CCGGGAGACTGGAAGGACCATAAACCTCGAGGTTTATGGTCCTTCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000570.3-732s21c1
Sequence:CCGGATAATTCTGACTTCCACATTCCTCGAGGAATGTGGAAGTCAGAATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-436s1c1
Sequence:CCGGGCTCTGCATAAGGTCACATATCTCGAGATATGTGACCTTATGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-691s1c1
Sequence:CCGGGCAGTGGACACAGGACTATATCTCGAGATATAGTCCTGTGTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-329s1c1
Sequence:CCGGCGGTGCAGCTAGAAGTCCATACTCGAGTATGGACTTCTAGCTGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-594s1c1
Sequence:CCGGCATCACCATCACTCAAGGTTTCTCGAGAAACCTTGAGTGATGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-668s1c1
Sequence:CCGGGCTTGGTGATGGTACTCCTTTCTCGAGAAAGGAGTACCATCACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000570
FCGR3B MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, low affinity IIIb, receptor (CD16b)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000570.3-706s21c1
Sequence:CCGGTGGCAAAGACAGGAAGTATTTCTCGAGAAATACTTCCTGTCTTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000570.3-987s21c1
Sequence:CCGGGAGACTGGAAGGACCATAAACCTCGAGGTTTATGGTCCTTCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000570.3-732s21c1
Sequence:CCGGATAATTCTGACTTCCACATTCCTCGAGGAATGTGGAAGTCAGAATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-436s1c1
Sequence:CCGGGCTCTGCATAAGGTCACATATCTCGAGATATGTGACCTTATGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-691s1c1
Sequence:CCGGGCAGTGGACACAGGACTATATCTCGAGATATAGTCCTGTGTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-329s1c1
Sequence:CCGGCGGTGCAGCTAGAAGTCCATACTCGAGTATGGACTTCTAGCTGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-594s1c1
Sequence:CCGGCATCACCATCACTCAAGGTTTCTCGAGAAACCTTGAGTGATGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000570.1-668s1c1
Sequence:CCGGGCTTGGTGATGGTACTCCTTTCTCGAGAAAGGAGTACCATCACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks