EMAIL THIS PAGE TO A FRIEND

FCGRT

Fc fragment of IgG, receptor, transporter, alpha

158 Gene Product Result for
Synonyms: FCRN alpha-chain
UniProtKB ID: P55899, Q5HYM5, Q9HBV7, Q9NZ19
Gene ID:
Human(2217) Summary: This gene encodes a receptor that binds the Fc region of monomeric immunoglobulin G. The encoded protein transfers immunoglobulin G antibodies from mother to fetus across the placenta. This protein also binds immunoglobulin G to protect the antibody from degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(14132) Fc receptor, IgG, alpha chain transporter
Rat(29558) Fc fragment of IgG, receptor, transporter, alpha
sheep(100144766) Fc fragment of IgG, receptor, transporter, alpha
domestic guinea pig(101789149) Fc fragment of IgG, receptor, transporter, alpha
naked mole-rat(101726745) Fc fragment of IgG, receptor, transporter, alpha
cow(338062) Fc fragment of IgG, receptor, transporter, alpha
dog(476414) Fc fragment of IgG, receptor, transporter, alpha
domestic cat(101081512) Fc fragment of IgG, receptor, transporter, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004107 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004107 Rosetta Predictions human pricing
NM_033351 Rosetta Predictions rat pricing
NM_010189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193557 predicted 1233
2 SASI_Hs01_00193559 predicted 430
3 SASI_Hs01_00193560 predicted 449
4 SASI_Hs01_00193561 predicted 854
5 SASI_Hs01_00193562 predicted 668
6 SASI_Hs01_00193563 predicted 331
7 SASI_Hs01_00193558 predicted 1215
8 SASI_Hs01_00193564 predicted 371
9 SASI_Hs02_00336930 predicted 447
10 SASI_Hs01_00193565 predicted 1363
11 SASI_Hs01_00193566 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041176 predicted 1224
2 SASI_Rn01_00041177 predicted 787
3 SASI_Rn01_00041178 predicted 1005
4 SASI_Rn01_00041180 predicted 675
5 SASI_Rn01_00041181 predicted 1066
6 SASI_Rn01_00041182 predicted 673
7 SASI_Rn01_00041183 predicted 283
8 SASI_Rn01_00041184 predicted 902
9 SASI_Rn01_00041185 predicted 673
10 SASI_Rn02_00265538 predicted 1102
11 SASI_Rn01_00041179 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152534 predicted 1142
2 SASI_Mm01_00152538 predicted 905
3 SASI_Mm01_00152539 predicted 850
4 SASI_Mm02_00317987 predicted 532
5 SASI_Mm02_00317988 predicted 1163
6 SASI_Mm01_00152540 predicted 1234
7 SASI_Mm01_00152542 predicted 1248
8 SASI_Mm01_00152543 predicted 850
9 SASI_Mm02_00317989 predicted 1265
10 SASI_Mm02_00317990 predicted 1243
11 SASI_Mm01_00152535 predicted 826
12 SASI_Mm01_00152536 predicted 802
13 SASI_Mm01_00152537 predicted 341
14 SASI_Mm01_00152541 predicted 803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010189
VALIDATED
FCGRT MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, receptor, transporter, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-825s1c1
Sequence:CCGGCGTGGAGATGAGCACCATTATCTCGAGATAATGGTGCTCATCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-939s1c1
Sequence:CCGGCTTGGTTTATTGCTGGTGGTACTCGAGTACCACCAGCAATAAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010189.1-503s1c1
Sequence:CCGGCGTTGCTAATCTGTGGATGAACTCGAGTTCATCCACAGATTAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-338s1c1
Sequence:CCGGGAAGATATTAAATGGGACCTACTCGAGTAGGTCCCATTTAATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-1099s1c1
Sequence:CCGGCAAATGCCTTTCCAGCCACTTCTCGAGAAGTGGCTGGAAAGGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010189
VALIDATED
FCGRT MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, receptor, transporter, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-825s1c1
Sequence:CCGGCGTGGAGATGAGCACCATTATCTCGAGATAATGGTGCTCATCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-939s1c1
Sequence:CCGGCTTGGTTTATTGCTGGTGGTACTCGAGTACCACCAGCAATAAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010189.1-503s1c1
Sequence:CCGGCGTTGCTAATCTGTGGATGAACTCGAGTTCATCCACAGATTAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-338s1c1
Sequence:CCGGGAAGATATTAAATGGGACCTACTCGAGTAGGTCCCATTTAATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-1099s1c1
Sequence:CCGGCAAATGCCTTTCCAGCCACTTCTCGAGAAGTGGCTGGAAAGGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010189
VALIDATED
FCGRT MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, receptor, transporter, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-825s1c1
Sequence:CCGGCGTGGAGATGAGCACCATTATCTCGAGATAATGGTGCTCATCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-939s1c1
Sequence:CCGGCTTGGTTTATTGCTGGTGGTACTCGAGTACCACCAGCAATAAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010189.1-503s1c1
Sequence:CCGGCGTTGCTAATCTGTGGATGAACTCGAGTTCATCCACAGATTAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-338s1c1
Sequence:CCGGGAAGATATTAAATGGGACCTACTCGAGTAGGTCCCATTTAATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010189.1-1099s1c1
Sequence:CCGGCAAATGCCTTTCCAGCCACTTCTCGAGAAGTGGCTGGAAAGGCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004107
VALIDATED
FCGRT MISSION shRNA Bacterial Glycerol Stock
Fc fragment of IgG, receptor, transporter, alpha
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004107.3-574s1c1
Sequence:CCGGCGGCGAGGAGTTCATGAATTTCTCGAGAAATTCATGAACTCCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004107.3-583s1c1
Sequence:CCGGGTTCATGAATTTCGACCTCAACTCGAGTTGAGGTCGAAATTCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004107.3-408s1c1
Sequence:CCGGCCTGGTATTGGGAGAAAGAGACTCGAGTCTCTTTCTCCCAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004107.3-944s1c1
Sequence:CCGGTCGTCGTCACTAACAGTCAAACTCGAGTTTGACTGTTAGTGACGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004107.4-916s21c1
Sequence:CCGGCAACTTCGGTTCCTGCGGAATCTCGAGATTCCGCAGGAACCGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004107.4-744s21c1
Sequence:CCGGGCTCACCTTCCTGCTATTCTCCTCGAGGAGAATAGCAGGAAGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004107.4-510s21c1
Sequence:CCGGGCTCTTTCTGGAAGCTTTCAACTCGAGTTGAAAGCTTCCAGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004107
VALIDATED
FCGRT MISSION shRNA shRNA Plasmid DNA
Fc fragment of IgG, receptor, transporter, alpha
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004107.3-574s1c1
Sequence:CCGGCGGCGAGGAGTTCATGAATTTCTCGAGAAATTCATGAACTCCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004107.3-583s1c1
Sequence:CCGGGTTCATGAATTTCGACCTCAACTCGAGTTGAGGTCGAAATTCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004107.3-408s1c1
Sequence:CCGGCCTGGTATTGGGAGAAAGAGACTCGAGTCTCTTTCTCCCAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004107.3-944s1c1
Sequence:CCGGTCGTCGTCACTAACAGTCAAACTCGAGTTTGACTGTTAGTGACGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004107.4-916s21c1
Sequence:CCGGCAACTTCGGTTCCTGCGGAATCTCGAGATTCCGCAGGAACCGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004107.4-744s21c1
Sequence:CCGGGCTCACCTTCCTGCTATTCTCCTCGAGGAGAATAGCAGGAAGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004107.4-510s21c1
Sequence:CCGGGCTCTTTCTGGAAGCTTTCAACTCGAGTTGAAAGCTTCCAGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004107
VALIDATED
FCGRT MISSION shRNA Lentiviral Transduction Particles
Fc fragment of IgG, receptor, transporter, alpha
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004107.3-574s1c1
Sequence:CCGGCGGCGAGGAGTTCATGAATTTCTCGAGAAATTCATGAACTCCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004107.3-583s1c1
Sequence:CCGGGTTCATGAATTTCGACCTCAACTCGAGTTGAGGTCGAAATTCATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004107.3-408s1c1
Sequence:CCGGCCTGGTATTGGGAGAAAGAGACTCGAGTCTCTTTCTCCCAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004107.3-944s1c1
Sequence:CCGGTCGTCGTCACTAACAGTCAAACTCGAGTTTGACTGTTAGTGACGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004107.4-916s21c1
Sequence:CCGGCAACTTCGGTTCCTGCGGAATCTCGAGATTCCGCAGGAACCGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004107.4-744s21c1
Sequence:CCGGGCTCACCTTCCTGCTATTCTCCTCGAGGAGAATAGCAGGAAGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004107.4-510s21c1
Sequence:CCGGGCTCTTTCTGGAAGCTTTCAACTCGAGTTGAAAGCTTCCAGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks