EMAIL THIS PAGE TO A FRIEND

FCHO1

FCH domain only 1

81 Gene Product Result for
UniProtKB ID: O14526, A6NHE6, A8K5U5, B4E120, Q05C93, Q8IW22
Gene ID:
Mouse(74015) FCH domain only 1
Rat(290639) FCH domain only 1
Zebrafish(100913078) FCH domain only 1
domestic cat(101084606) FCH domain only 1
dog(476673) FCH domain only 1
cow(505672) FCH domain only 1
naked mole-rat(101712757) FCH domain only 1
domestic guinea pig(100733017) FCH domain only 1
sheep(101110837) FCH domain only 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015122 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015122 Rosetta Predictions human pricing
NM_001106069 Rosetta Predictions rat pricing
NM_028715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127807 predicted 2266
2 SASI_Hs01_00127808 predicted 2352
3 SASI_Hs02_00347024 predicted 589
4 SASI_Hs01_00127809 predicted 2302
5 SASI_Hs01_00127810 predicted 1552
6 SASI_Hs01_00127811 predicted 708
7 SASI_Hs01_00127812 predicted 497
8 SASI_Hs01_00127813 predicted 2861
9 SASI_Hs01_00127814 predicted 2832
10 SASI_Hs01_00127815 predicted 1096
11 SASI_Hs01_00127816 predicted 2282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215322 predicted 2061
2 SASI_Rn02_00215323 predicted 2190
3 SASI_Rn02_00215324 predicted 2431
4 SASI_Rn02_00215325 predicted 1557
5 SASI_Rn02_00215326 predicted 1151
6 SASI_Rn02_00215327 predicted 2384
7 SASI_Rn02_00215328 predicted 2533
8 SASI_Rn02_00215329 predicted 1980
9 SASI_Rn02_00215330 predicted 1320
10 SASI_Rn02_00215331 predicted 2207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072037 predicted 506
2 SASI_Mm01_00072038 predicted 1064
3 SASI_Mm01_00072039 predicted 2248
4 SASI_Mm01_00072040 predicted 2154
5 SASI_Mm01_00072041 predicted 2233
6 SASI_Mm01_00072042 predicted 1261
7 SASI_Mm01_00072043 predicted 215
8 SASI_Mm02_00334260 predicted 2164
9 SASI_Mm01_00072044 predicted 2173
10 SASI_Mm01_00072045 predicted 703
11 SASI_Mm01_00072046 predicted 1273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015122
FCHO1 MISSION shRNA Bacterial Glycerol Stock
FCH domain only 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1061s1c1
Sequence:CCGGGCAGGAAGCGATGAAACGTTTCTCGAGAAACGTTTCATCGCTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-923s1c1
Sequence:CCGGGCAGGTGCATGAGGAATTTAACTCGAGTTAAATTCCTCATGCACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1298s1c1
Sequence:CCGGCAAGTTCTATGTGCACATCAACTCGAGTTGATGTGCACATAGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1297s1c1
Sequence:CCGGGCAAGTTCTATGTGCACATCACTCGAGTGATGTGCACATAGAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-969s1c1
Sequence:CCGGGAGATGCTACTCAGGAAGTTTCTCGAGAAACTTCCTGAGTAGCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-2354s1c1
Sequence:CCGGCAAAGACTTCTGGCTCAACATCTCGAGATGTTGAGCCAGAAGTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1295s1c1
Sequence:CCGGCCGCAAGTTCTATGTGCACATCTCGAGATGTGCACATAGAACTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-2270s1c1
Sequence:CCGGGCTTGTACACACAACCGCTATCTCGAGATAGCGGTTGTGTGTACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-2279s1c1
Sequence:CCGGCACAACCGCTATTGAGCACTTCTCGAGAAGTGCTCAATAGCGGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-554s1c1
Sequence:CCGGCAAGACCCACAAGAAGTGCAACTCGAGTTGCACTTCTTGTGGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1186s1c1
Sequence:CCGGCAGAGGTGGATGAAGAAGGTTCTCGAGAACCTTCTTCATCCACCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015122
FCHO1 MISSION shRNA shRNA Plasmid DNA
FCH domain only 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1061s1c1
Sequence:CCGGGCAGGAAGCGATGAAACGTTTCTCGAGAAACGTTTCATCGCTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-923s1c1
Sequence:CCGGGCAGGTGCATGAGGAATTTAACTCGAGTTAAATTCCTCATGCACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1298s1c1
Sequence:CCGGCAAGTTCTATGTGCACATCAACTCGAGTTGATGTGCACATAGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1297s1c1
Sequence:CCGGGCAAGTTCTATGTGCACATCACTCGAGTGATGTGCACATAGAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-969s1c1
Sequence:CCGGGAGATGCTACTCAGGAAGTTTCTCGAGAAACTTCCTGAGTAGCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-2354s1c1
Sequence:CCGGCAAAGACTTCTGGCTCAACATCTCGAGATGTTGAGCCAGAAGTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1295s1c1
Sequence:CCGGCCGCAAGTTCTATGTGCACATCTCGAGATGTGCACATAGAACTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-2270s1c1
Sequence:CCGGGCTTGTACACACAACCGCTATCTCGAGATAGCGGTTGTGTGTACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-2279s1c1
Sequence:CCGGCACAACCGCTATTGAGCACTTCTCGAGAAGTGCTCAATAGCGGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-554s1c1
Sequence:CCGGCAAGACCCACAAGAAGTGCAACTCGAGTTGCACTTCTTGTGGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1186s1c1
Sequence:CCGGCAGAGGTGGATGAAGAAGGTTCTCGAGAACCTTCTTCATCCACCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015122
FCHO1 MISSION shRNA Lentiviral Transduction Particles
FCH domain only 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1061s1c1
Sequence:CCGGGCAGGAAGCGATGAAACGTTTCTCGAGAAACGTTTCATCGCTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-923s1c1
Sequence:CCGGGCAGGTGCATGAGGAATTTAACTCGAGTTAAATTCCTCATGCACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1298s1c1
Sequence:CCGGCAAGTTCTATGTGCACATCAACTCGAGTTGATGTGCACATAGAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1297s1c1
Sequence:CCGGGCAAGTTCTATGTGCACATCACTCGAGTGATGTGCACATAGAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-969s1c1
Sequence:CCGGGAGATGCTACTCAGGAAGTTTCTCGAGAAACTTCCTGAGTAGCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-2354s1c1
Sequence:CCGGCAAAGACTTCTGGCTCAACATCTCGAGATGTTGAGCCAGAAGTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1295s1c1
Sequence:CCGGCCGCAAGTTCTATGTGCACATCTCGAGATGTGCACATAGAACTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-2270s1c1
Sequence:CCGGGCTTGTACACACAACCGCTATCTCGAGATAGCGGTTGTGTGTACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-2279s1c1
Sequence:CCGGCACAACCGCTATTGAGCACTTCTCGAGAAGTGCTCAATAGCGGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-554s1c1
Sequence:CCGGCAAGACCCACAAGAAGTGCAACTCGAGTTGCACTTCTTGTGGGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015122.1-1186s1c1
Sequence:CCGGCAGAGGTGGATGAAGAAGGTTCTCGAGAACCTTCTTCATCCACCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028715
FCHO1 MISSION shRNA Bacterial Glycerol Stock
FCH domain only 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-1065s1c1
Sequence:CCGGCCCGATATATCTCAGAACAATCTCGAGATTGTTCTGAGATATATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-1935s1c1
Sequence:CCGGGCCTTCACTGAGTATGTCCATCTCGAGATGGACATACTCAGTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-2239s1c1
Sequence:CCGGCCTACTACAACCTGGTGCTATCTCGAGATAGCACCAGGTTGTAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-789s1c1
Sequence:CCGGCATGAGGAATTTAAGCAGAATCTCGAGATTCTGCTTAAATTCCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-491s1c1
Sequence:CCGGCCTGCCAAAGTCTCGCGAGAACTCGAGTTCTCGCGAGACTTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028715
FCHO1 MISSION shRNA shRNA Plasmid DNA
FCH domain only 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-1065s1c1
Sequence:CCGGCCCGATATATCTCAGAACAATCTCGAGATTGTTCTGAGATATATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-1935s1c1
Sequence:CCGGGCCTTCACTGAGTATGTCCATCTCGAGATGGACATACTCAGTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-2239s1c1
Sequence:CCGGCCTACTACAACCTGGTGCTATCTCGAGATAGCACCAGGTTGTAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-789s1c1
Sequence:CCGGCATGAGGAATTTAAGCAGAATCTCGAGATTCTGCTTAAATTCCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-491s1c1
Sequence:CCGGCCTGCCAAAGTCTCGCGAGAACTCGAGTTCTCGCGAGACTTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028715
FCHO1 MISSION shRNA Lentiviral Transduction Particles
FCH domain only 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-1065s1c1
Sequence:CCGGCCCGATATATCTCAGAACAATCTCGAGATTGTTCTGAGATATATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-1935s1c1
Sequence:CCGGGCCTTCACTGAGTATGTCCATCTCGAGATGGACATACTCAGTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-2239s1c1
Sequence:CCGGCCTACTACAACCTGGTGCTATCTCGAGATAGCACCAGGTTGTAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-789s1c1
Sequence:CCGGCATGAGGAATTTAAGCAGAATCTCGAGATTCTGCTTAAATTCCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028715.2-491s1c1
Sequence:CCGGCCTGCCAAAGTCTCGCGAGAACTCGAGTTCTCGCGAGACTTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)