EMAIL THIS PAGE TO A FRIEND

FCHO2

FCH domain only 2

184 Gene Product Result for
Gene ID:
Mouse(218503) FCH domain only 2
Rat(309129) FCH domain only 2
sheep(101114903) FCH domain only 2
domestic guinea pig(100732435) FCH domain only 2
naked mole-rat(101714755) FCH domain only 2
Zebrafish(553949) FCH domain only 2
Horse(100065702) FCH domain only 2
domestic cat(101096444) FCH domain only 2
dog(478094) FCH domain only 2
chicken(769464) FCH domain only 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138782 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138782 Rosetta Predictions human pricing
XM_219503 Rosetta Predictions rat pricing
NM_172591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094179 predicted 1825
2 SASI_Hs01_00094180 predicted 229
3 SASI_Hs01_00094181 predicted 2395
4 SASI_Hs01_00094182 predicted 2106
5 SASI_Hs01_00094185 predicted 1726
6 SASI_Hs01_00094186 predicted 1131
7 SASI_Hs02_00363905 predicted 982
8 SASI_Hs01_00094188 predicted 1376
9 SASI_Hs02_00363906 predicted 1229
10 SASI_Hs02_00363907 predicted 1285
11 SASI_Hs01_00094183 predicted 1987
12 SASI_Hs01_00094184 predicted 1532
13 SASI_Hs01_00094187 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378515 predicted 2871
2 SASI_Rn02_00378516 predicted 2337
3 SASI_Rn02_00378517 predicted 1021
4 SASI_Rn02_00378518 predicted 2769
5 SASI_Rn02_00378519 predicted 454
6 SASI_Rn02_00378520 predicted 2366
7 SASI_Rn02_00378521 predicted 1827
8 SASI_Rn02_00378522 predicted 2787
9 SASI_Rn02_00378523 predicted 1409
10 SASI_Rn02_00378524 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173553 predicted 1716
2 SASI_Mm02_00344281 predicted 2082
3 SASI_Mm01_00173555 predicted 2550
4 SASI_Mm01_00173556 predicted 2005
5 SASI_Mm01_00173557 predicted 2398
6 SASI_Mm01_00173559 predicted 2328
7 SASI_Mm01_00173560 predicted 2445
8 SASI_Mm01_00173561 predicted 1163
9 SASI_Mm02_00344282 predicted 2363
10 SASI_Mm02_00344283 predicted 720
11 SASI_Mm01_00173554 predicted 763
12 SASI_Mm01_00173558 predicted 1982
13 SASI_Mm01_00173562 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172591
VALIDATED
FCHO2 MISSION shRNA Bacterial Glycerol Stock
FCH domain only 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172591.2-1152s1c1
Sequence:CCGGGCTTCTTTGGATGAACTGAAACTCGAGTTTCAGTTCATCCAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-1122s1c1
Sequence:CCGGGCGCATCCAAATAACTTGCATCTCGAGATGCAAGTTATTTGGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-2012s1c1
Sequence:CCGGCCAGGTATCATCAAATGGCATCTCGAGATGCCATTTGATGATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-2407s1c1
Sequence:CCGGGCTATAGACTTTCCTTAGTAACTCGAGTTACTAAGGAAAGTCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-831s1c1
Sequence:CCGGCCTGGTCTTATTGAATTTGAACTCGAGTTCAAATTCAATAAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-2791s1c1
Sequence:CCGGGCACAGAAGTTATTTAGCTTTCTCGAGAAAGCTAAATAACTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172591.2-209s1c1
Sequence:CCGGGAAATCTGCAAGCAATTATTCCTCGAGGAATAATTGCTTGCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172591.2-3100s1c1
Sequence:CCGGCAACTTACTTCTGCGTTAATTCTCGAGAATTAACGCAGAAGTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172591.2-2759s1c1
Sequence:CCGGGTAGTAACAAGCCTAACATTTCTCGAGAAATGTTAGGCTTGTTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172591.2-961s1c1
Sequence:CCGGCTGATGCAGATTCGCTTAATACTCGAGTATTAAGCGAATCTGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172591
VALIDATED
FCHO2 MISSION shRNA shRNA Plasmid DNA
FCH domain only 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172591.2-1152s1c1
Sequence:CCGGGCTTCTTTGGATGAACTGAAACTCGAGTTTCAGTTCATCCAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-1122s1c1
Sequence:CCGGGCGCATCCAAATAACTTGCATCTCGAGATGCAAGTTATTTGGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-2012s1c1
Sequence:CCGGCCAGGTATCATCAAATGGCATCTCGAGATGCCATTTGATGATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-2407s1c1
Sequence:CCGGGCTATAGACTTTCCTTAGTAACTCGAGTTACTAAGGAAAGTCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-831s1c1
Sequence:CCGGCCTGGTCTTATTGAATTTGAACTCGAGTTCAAATTCAATAAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-2791s1c1
Sequence:CCGGGCACAGAAGTTATTTAGCTTTCTCGAGAAAGCTAAATAACTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172591.2-209s1c1
Sequence:CCGGGAAATCTGCAAGCAATTATTCCTCGAGGAATAATTGCTTGCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172591.2-3100s1c1
Sequence:CCGGCAACTTACTTCTGCGTTAATTCTCGAGAATTAACGCAGAAGTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172591.2-2759s1c1
Sequence:CCGGGTAGTAACAAGCCTAACATTTCTCGAGAAATGTTAGGCTTGTTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172591.2-961s1c1
Sequence:CCGGCTGATGCAGATTCGCTTAATACTCGAGTATTAAGCGAATCTGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172591
VALIDATED
FCHO2 MISSION shRNA Lentiviral Transduction Particles
FCH domain only 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172591.2-1152s1c1
Sequence:CCGGGCTTCTTTGGATGAACTGAAACTCGAGTTTCAGTTCATCCAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-1122s1c1
Sequence:CCGGGCGCATCCAAATAACTTGCATCTCGAGATGCAAGTTATTTGGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-2012s1c1
Sequence:CCGGCCAGGTATCATCAAATGGCATCTCGAGATGCCATTTGATGATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-2407s1c1
Sequence:CCGGGCTATAGACTTTCCTTAGTAACTCGAGTTACTAAGGAAAGTCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-831s1c1
Sequence:CCGGCCTGGTCTTATTGAATTTGAACTCGAGTTCAAATTCAATAAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172591.2-2791s1c1
Sequence:CCGGGCACAGAAGTTATTTAGCTTTCTCGAGAAAGCTAAATAACTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172591.2-209s1c1
Sequence:CCGGGAAATCTGCAAGCAATTATTCCTCGAGGAATAATTGCTTGCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172591.2-3100s1c1
Sequence:CCGGCAACTTACTTCTGCGTTAATTCTCGAGAATTAACGCAGAAGTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172591.2-2759s1c1
Sequence:CCGGGTAGTAACAAGCCTAACATTTCTCGAGAAATGTTAGGCTTGTTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172591.2-961s1c1
Sequence:CCGGCTGATGCAGATTCGCTTAATACTCGAGTATTAAGCGAATCTGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138782
VALIDATED
FCHO2 MISSION shRNA Bacterial Glycerol Stock
FCH domain only 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138782.1-851s1c1
Sequence:CCGGGCTAGTGCAGTTGAAGGTATACTCGAGTATACCTTCAACTGCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138782.1-1433s1c1
Sequence:CCGGCCAAAGCTTACTTCAGGCAAACTCGAGTTTGCCTGAAGTAAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138782.1-990s1c1
Sequence:CCGGGCTACAGTATTAAACCAGAAACTCGAGTTTCTGGTTTAATACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138782.1-341s1c1
Sequence:CCGGGAAGAACAAGTAAAGTCTCATCTCGAGATGAGACTTTACTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138782.1-1583s1c1
Sequence:CCGGGCTGCCAATACTCCAACAGTACTCGAGTACTGTTGGAGTATTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-987s21c1
Sequence:CCGGGCTTTGCCAGGAATCATTAAACTCGAGTTTAATGATTCCTGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-1250s21c1
Sequence:CCGGAGTATCTATAGGGAATATAACCTCGAGGTTATATTCCCTATAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-1301s21c1
Sequence:CCGGAGTACAGATGAATCGGAATTTCTCGAGAAATTCCGATTCATCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-2488s21c1
Sequence:CCGGGCTATAGGCTTTCCTTAATAACTCGAGTTATTAAGGAAAGCCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138782.2-2667s21c1
Sequence:CCGGAGCTGACTACAAACATTAAATCTCGAGATTTAATGTTTGTAGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138782
VALIDATED
FCHO2 MISSION shRNA shRNA Plasmid DNA
FCH domain only 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138782.1-851s1c1
Sequence:CCGGGCTAGTGCAGTTGAAGGTATACTCGAGTATACCTTCAACTGCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138782.1-1433s1c1
Sequence:CCGGCCAAAGCTTACTTCAGGCAAACTCGAGTTTGCCTGAAGTAAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138782.1-990s1c1
Sequence:CCGGGCTACAGTATTAAACCAGAAACTCGAGTTTCTGGTTTAATACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138782.1-341s1c1
Sequence:CCGGGAAGAACAAGTAAAGTCTCATCTCGAGATGAGACTTTACTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138782.1-1583s1c1
Sequence:CCGGGCTGCCAATACTCCAACAGTACTCGAGTACTGTTGGAGTATTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-987s21c1
Sequence:CCGGGCTTTGCCAGGAATCATTAAACTCGAGTTTAATGATTCCTGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-1250s21c1
Sequence:CCGGAGTATCTATAGGGAATATAACCTCGAGGTTATATTCCCTATAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-1301s21c1
Sequence:CCGGAGTACAGATGAATCGGAATTTCTCGAGAAATTCCGATTCATCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-2488s21c1
Sequence:CCGGGCTATAGGCTTTCCTTAATAACTCGAGTTATTAAGGAAAGCCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138782.2-2667s21c1
Sequence:CCGGAGCTGACTACAAACATTAAATCTCGAGATTTAATGTTTGTAGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138782
VALIDATED
FCHO2 MISSION shRNA Lentiviral Transduction Particles
FCH domain only 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138782.1-851s1c1
Sequence:CCGGGCTAGTGCAGTTGAAGGTATACTCGAGTATACCTTCAACTGCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138782.1-1433s1c1
Sequence:CCGGCCAAAGCTTACTTCAGGCAAACTCGAGTTTGCCTGAAGTAAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138782.1-990s1c1
Sequence:CCGGGCTACAGTATTAAACCAGAAACTCGAGTTTCTGGTTTAATACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138782.1-341s1c1
Sequence:CCGGGAAGAACAAGTAAAGTCTCATCTCGAGATGAGACTTTACTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138782.1-1583s1c1
Sequence:CCGGGCTGCCAATACTCCAACAGTACTCGAGTACTGTTGGAGTATTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-987s21c1
Sequence:CCGGGCTTTGCCAGGAATCATTAAACTCGAGTTTAATGATTCCTGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-1250s21c1
Sequence:CCGGAGTATCTATAGGGAATATAACCTCGAGGTTATATTCCCTATAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-1301s21c1
Sequence:CCGGAGTACAGATGAATCGGAATTTCTCGAGAAATTCCGATTCATCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138782.2-2488s21c1
Sequence:CCGGGCTATAGGCTTTCCTTAATAACTCGAGTTATTAAGGAAAGCCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138782.2-2667s21c1
Sequence:CCGGAGCTGACTACAAACATTAAATCTCGAGATTTAATGTTTGTAGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks