EMAIL THIS PAGE TO A FRIEND

FCHSD1

FCH and double SH3 domains 1

201 Gene Product Result for
Synonyms: NWK2
UniProtKB ID: Q86WN1, Q6UX75, Q86Y77, Q9NXX8
Gene ID:
Mouse(319262) FCH and double SH3 domains 1
Rat(307482) FCH and double SH3 domains 1
chicken(427616) FCH and double SH3 domains 1
dog(487187) FCH and double SH3 domains 1
Horse(100072174) FCH and double SH3 domains 1
cow(529296) FCH and double SH3 domains 1
domestic cat(101101440) FCH and double SH3 domains 1
naked mole-rat(101710353) FCH and double SH3 domains 1
domestic guinea pig(100720376) FCH and double SH3 domains 1
sheep(101107351) FCH and double SH3 domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033449 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030441 MISSION® esiRNA esiRNA human FCHSD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033449 Rosetta Predictions human pricing
NM_001107392 Rosetta Predictions rat pricing
NM_175684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019332 predicted 681
2 SASI_Hs01_00019333 predicted 1592
3 SASI_Hs01_00019334 predicted 945
4 SASI_Hs01_00019335 predicted 1073
5 SASI_Hs01_00019336 predicted 2350
6 SASI_Hs01_00019337 predicted 1056
7 SASI_Hs01_00019338 predicted 857
8 SASI_Hs01_00019339 predicted 1158
9 SASI_Hs01_00019340 predicted 489
10 SASI_Hs01_00019341 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228365 predicted 3498
2 SASI_Rn02_00228366 predicted 3118
3 SASI_Rn02_00228367 predicted 3622
4 SASI_Rn02_00228368 predicted 3429
5 SASI_Rn02_00228369 predicted 3087
6 SASI_Rn02_00228370 predicted 3490
7 SASI_Rn02_00228371 predicted 3079
8 SASI_Rn02_00228372 predicted 3263
9 SASI_Rn02_00228373 predicted 2986
10 SASI_Rn02_00228374 predicted 3387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180574 predicted 1540
2 SASI_Mm01_00180576 predicted 1409
3 SASI_Mm01_00180577 predicted 683
4 SASI_Mm01_00180578 predicted 703
5 SASI_Mm01_00180579 predicted 738
6 SASI_Mm01_00180580 predicted 614
7 SASI_Mm02_00346620 predicted 1772
8 SASI_Mm01_00180581 predicted 1266
9 SASI_Mm01_00180582 predicted 1426
10 SASI_Mm01_00180583 predicted 2075
11 SASI_Mm01_00180575 predicted 1684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175684
FCHSD1 MISSION shRNA Bacterial Glycerol Stock
FCH and double SH3 domains 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-1549s21c1
Sequence:CCGGGCTTTGTCCCTGAGCGATATCCTCGAGGATATCGCTCAGGGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-145s21c1
Sequence:CCGGCAGCCATTGAACGGGAGTATGCTCGAGCATACTCCCGTTCAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175684.4-2495s21c1
Sequence:CCGGTAATGGTCTGAGCGGATTTATCTCGAGATAAATCCGCTCAGACCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-1982s21c1
Sequence:CCGGCATGATGGTGCCTCGACTTAGCTCGAGCTAAGTCGAGGCACCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-622s21c1
Sequence:CCGGGCAATGAGTACCTGCTAAATTCTCGAGAATTTAGCAGGTACTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175684.3-2507s1c1
Sequence:CCGGCGGATTTATTGACAGTGAATACTCGAGTATTCACTGTCAATAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-837s1c1
Sequence:CCGGGAACAAGATGTGAAGCTGTTTCTCGAGAAACAGCTTCACATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175684.3-2506s1c1
Sequence:CCGGGCGGATTTATTGACAGTGAATCTCGAGATTCACTGTCAATAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-812s1c1
Sequence:CCGGGAAGGCAACGTCTCAGGTAAACTCGAGTTTACCTGAGACGTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-1320s1c1
Sequence:CCGGGCTGAGCTTTCTGACTTCGATCTCGAGATCGAAGTCAGAAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-38s1c1
Sequence:CCGGCCAGGAGGTTAAACTTCGCTTCTCGAGAAGCGAAGTTTAACCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175684
FCHSD1 MISSION shRNA shRNA Plasmid DNA
FCH and double SH3 domains 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-1549s21c1
Sequence:CCGGGCTTTGTCCCTGAGCGATATCCTCGAGGATATCGCTCAGGGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-145s21c1
Sequence:CCGGCAGCCATTGAACGGGAGTATGCTCGAGCATACTCCCGTTCAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175684.4-2495s21c1
Sequence:CCGGTAATGGTCTGAGCGGATTTATCTCGAGATAAATCCGCTCAGACCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-1982s21c1
Sequence:CCGGCATGATGGTGCCTCGACTTAGCTCGAGCTAAGTCGAGGCACCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-622s21c1
Sequence:CCGGGCAATGAGTACCTGCTAAATTCTCGAGAATTTAGCAGGTACTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175684.3-2507s1c1
Sequence:CCGGCGGATTTATTGACAGTGAATACTCGAGTATTCACTGTCAATAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-837s1c1
Sequence:CCGGGAACAAGATGTGAAGCTGTTTCTCGAGAAACAGCTTCACATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175684.3-2506s1c1
Sequence:CCGGGCGGATTTATTGACAGTGAATCTCGAGATTCACTGTCAATAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-812s1c1
Sequence:CCGGGAAGGCAACGTCTCAGGTAAACTCGAGTTTACCTGAGACGTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-1320s1c1
Sequence:CCGGGCTGAGCTTTCTGACTTCGATCTCGAGATCGAAGTCAGAAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-38s1c1
Sequence:CCGGCCAGGAGGTTAAACTTCGCTTCTCGAGAAGCGAAGTTTAACCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175684
FCHSD1 MISSION shRNA Lentiviral Transduction Particles
FCH and double SH3 domains 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-1549s21c1
Sequence:CCGGGCTTTGTCCCTGAGCGATATCCTCGAGGATATCGCTCAGGGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-145s21c1
Sequence:CCGGCAGCCATTGAACGGGAGTATGCTCGAGCATACTCCCGTTCAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175684.4-2495s21c1
Sequence:CCGGTAATGGTCTGAGCGGATTTATCTCGAGATAAATCCGCTCAGACCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-1982s21c1
Sequence:CCGGCATGATGGTGCCTCGACTTAGCTCGAGCTAAGTCGAGGCACCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175684.4-622s21c1
Sequence:CCGGGCAATGAGTACCTGCTAAATTCTCGAGAATTTAGCAGGTACTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175684.3-2507s1c1
Sequence:CCGGCGGATTTATTGACAGTGAATACTCGAGTATTCACTGTCAATAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-837s1c1
Sequence:CCGGGAACAAGATGTGAAGCTGTTTCTCGAGAAACAGCTTCACATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175684.3-2506s1c1
Sequence:CCGGGCGGATTTATTGACAGTGAATCTCGAGATTCACTGTCAATAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-812s1c1
Sequence:CCGGGAAGGCAACGTCTCAGGTAAACTCGAGTTTACCTGAGACGTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-1320s1c1
Sequence:CCGGGCTGAGCTTTCTGACTTCGATCTCGAGATCGAAGTCAGAAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175684.3-38s1c1
Sequence:CCGGCCAGGAGGTTAAACTTCGCTTCTCGAGAAGCGAAGTTTAACCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033449
VALIDATED
FCHSD1 MISSION shRNA Bacterial Glycerol Stock
FCH and double SH3 domains 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033449.1-1608s1c1
Sequence:CCGGCCCTGAGCGATATCTCAACTTCTCGAGAAGTTGAGATATCGCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-672s1c1
Sequence:CCGGCCGCAATGAGTACCTGCTTAACTCGAGTTAAGCAGGTACTCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033449.1-688s1c1
Sequence:CCGGCTTAACTTGGTGGCTACCAATCTCGAGATTGGTAGCCACCAAGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-892s1c1
Sequence:CCGGCAAGACCTGAAGCTGTTTCTTCTCGAGAAGAAACAGCTTCAGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-1066s1c1
Sequence:CCGGGACTACAAGATCCAGAACCATCTCGAGATGGTTCTGGATCTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033449.1-2569s1c1
Sequence:CCGGGCGGATTTATTGACAATGAATCTCGAGATTCATTGTCAATAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033449.1-2307s1c1
Sequence:CCGGCCCATTGTTCTATCATCTCTACTCGAGTAGAGATGATAGAACAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-1147s1c1
Sequence:CCGGCCAAGCATAGAACAGAGGTTACTCGAGTAACCTCTGTTCTATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033449
VALIDATED
FCHSD1 MISSION shRNA shRNA Plasmid DNA
FCH and double SH3 domains 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033449.1-1608s1c1
Sequence:CCGGCCCTGAGCGATATCTCAACTTCTCGAGAAGTTGAGATATCGCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-672s1c1
Sequence:CCGGCCGCAATGAGTACCTGCTTAACTCGAGTTAAGCAGGTACTCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033449.1-688s1c1
Sequence:CCGGCTTAACTTGGTGGCTACCAATCTCGAGATTGGTAGCCACCAAGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-892s1c1
Sequence:CCGGCAAGACCTGAAGCTGTTTCTTCTCGAGAAGAAACAGCTTCAGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-1066s1c1
Sequence:CCGGGACTACAAGATCCAGAACCATCTCGAGATGGTTCTGGATCTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033449.1-2569s1c1
Sequence:CCGGGCGGATTTATTGACAATGAATCTCGAGATTCATTGTCAATAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033449.1-2307s1c1
Sequence:CCGGCCCATTGTTCTATCATCTCTACTCGAGTAGAGATGATAGAACAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-1147s1c1
Sequence:CCGGCCAAGCATAGAACAGAGGTTACTCGAGTAACCTCTGTTCTATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033449
VALIDATED
FCHSD1 MISSION shRNA Lentiviral Transduction Particles
FCH and double SH3 domains 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033449.1-1608s1c1
Sequence:CCGGCCCTGAGCGATATCTCAACTTCTCGAGAAGTTGAGATATCGCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-672s1c1
Sequence:CCGGCCGCAATGAGTACCTGCTTAACTCGAGTTAAGCAGGTACTCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033449.1-688s1c1
Sequence:CCGGCTTAACTTGGTGGCTACCAATCTCGAGATTGGTAGCCACCAAGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-892s1c1
Sequence:CCGGCAAGACCTGAAGCTGTTTCTTCTCGAGAAGAAACAGCTTCAGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-1066s1c1
Sequence:CCGGGACTACAAGATCCAGAACCATCTCGAGATGGTTCTGGATCTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033449.1-2569s1c1
Sequence:CCGGGCGGATTTATTGACAATGAATCTCGAGATTCATTGTCAATAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033449.1-2307s1c1
Sequence:CCGGCCCATTGTTCTATCATCTCTACTCGAGTAGAGATGATAGAACAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033449.1-1147s1c1
Sequence:CCGGCCAAGCATAGAACAGAGGTTACTCGAGTAACCTCTGTTCTATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks