EMAIL THIS PAGE TO A FRIEND

FCHSD2

FCH and double SH3 domains 2

150 Gene Product Result for
Synonyms: NWK SH3MD3
UniProtKB ID: O94868, B4DNI3, Q7L8J9, Q8WVM2, Q96FV7, Q9UF77
Gene ID:
Mouse(207278) FCH and double SH3 domains 2
Rat(308864) FCH and double SH3 domains 2
sheep(101123405) FCH and double SH3 domains 2
Domestic Rabbit(100340980) FCH and double SH3 domains 2
domestic guinea pig(100730419) FCH and double SH3 domains 2
naked mole-rat(101721791) FCH and double SH3 domains 2
chicken(419068) FCH and double SH3 domains 2
cow(539601) FCH and double SH3 domains 2
Horse(100065828) FCH and double SH3 domains 2
domestic cat(101094622) FCH and double SH3 domains 2
dog(485204) FCH and double SH3 domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014824 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_374907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374907 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014824 Rosetta Predictions human pricing
NM_001107539 Rosetta Predictions rat pricing
NM_199012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023461 predicted 2314
2 SASI_Hs01_00023462 predicted 624
3 SASI_Hs02_00346359 predicted 385
4 SASI_Hs01_00023463 predicted 879
5 SASI_Hs01_00023464 predicted 1734
6 SASI_Hs02_00346360 predicted 891
7 SASI_Hs01_00023465 predicted 936
8 SASI_Hs01_00023466 predicted 811
9 SASI_Hs02_00346361 predicted 1130
10 SASI_Hs02_00346362 predicted 1523
11 SASI_Hs01_00023460 predicted 748
12 SASI_Hs01_00023467 predicted 744
13 SASI_Hs01_00023468 predicted 686
14 SASI_Hs01_00023469 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229825 predicted 874
2 SASI_Rn02_00229826 predicted 1426
3 SASI_Rn02_00229827 predicted 682
4 SASI_Rn02_00229828 predicted 994
5 SASI_Rn02_00229829 predicted 1476
6 SASI_Rn02_00229830 predicted 543
7 SASI_Rn02_00229831 predicted 1726
8 SASI_Rn02_00229832 predicted 1249
9 SASI_Rn02_00229833 predicted 470
10 SASI_Rn02_00229834 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195193 predicted 1747
2 SASI_Mm01_00195194 predicted 1935
3 SASI_Mm01_00195195 predicted 1185
4 SASI_Mm01_00195196 predicted 2544
5 SASI_Mm02_00351262 predicted 375
6 SASI_Mm01_00195197 predicted 428
7 SASI_Mm02_00351263 predicted 908
8 SASI_Mm01_00195199 predicted 706
9 SASI_Mm01_00195200 predicted 1572
10 SASI_Mm01_00195202 predicted 1036
11 SASI_Mm01_00195198 predicted 1801
12 SASI_Mm01_00195201 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199012
VALIDATED
FCHSD2 MISSION shRNA Bacterial Glycerol Stock
FCH and double SH3 domains 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000197684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199012.1-795s1c1
Sequence:CCGGCGATCTGAATGTAATACCAAACTCGAGTTTGGTATTACATTCAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199012.1-876s1c1
Sequence:CCGGCGCTACTATCAAACAGACTTACTCGAGTAAGTCTGTTTGATAGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199012.1-3034s1c1
Sequence:CCGGGCACATCTCTTCCTCAACTAACTCGAGTTAGTTGAGGAAGAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199012.1-4000s1c1
Sequence:CCGGGCTGATCTTCAAAGTGCTTATCTCGAGATAAGCACTTTGAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199012
VALIDATED
FCHSD2 MISSION shRNA shRNA Plasmid DNA
FCH and double SH3 domains 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000197684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199012.1-795s1c1
Sequence:CCGGCGATCTGAATGTAATACCAAACTCGAGTTTGGTATTACATTCAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199012.1-876s1c1
Sequence:CCGGCGCTACTATCAAACAGACTTACTCGAGTAAGTCTGTTTGATAGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199012.1-3034s1c1
Sequence:CCGGGCACATCTCTTCCTCAACTAACTCGAGTTAGTTGAGGAAGAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199012.1-4000s1c1
Sequence:CCGGGCTGATCTTCAAAGTGCTTATCTCGAGATAAGCACTTTGAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199012
VALIDATED
FCHSD2 MISSION shRNA Lentiviral Transduction Particles
FCH and double SH3 domains 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000197684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199012.1-795s1c1
Sequence:CCGGCGATCTGAATGTAATACCAAACTCGAGTTTGGTATTACATTCAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199012.1-876s1c1
Sequence:CCGGCGCTACTATCAAACAGACTTACTCGAGTAAGTCTGTTTGATAGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199012.1-3034s1c1
Sequence:CCGGGCACATCTCTTCCTCAACTAACTCGAGTTAGTTGAGGAAGAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199012.1-4000s1c1
Sequence:CCGGGCTGATCTTCAAAGTGCTTATCTCGAGATAAGCACTTTGAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014824
VALIDATED
FCHSD2 MISSION shRNA Bacterial Glycerol Stock
FCH and double SH3 domains 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014824.1-2850s1c1
Sequence:CCGGGCCCTGAATTTAGCACCAATTCTCGAGAATTGGTGCTAAATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147035    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014824.1-3054s1c1
Sequence:CCGGCGGATCTGAAATTAGCCAATACTCGAGTATTGGCTAATTTCAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014824.1-1378s1c1
Sequence:CCGGCGCTTAATGCAGATACCGAAACTCGAGTTTCGGTATCTGCATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014824.1-302s1c1
Sequence:CCGGGAATGATTACAGGAGCATGTACTCGAGTACATGCTCCTGTAATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014824.1-999s1c1
Sequence:CCGGCGACAGTTAGAATCAGAAACTCTCGAGAGTTTCTGATTCTAACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014824
VALIDATED
FCHSD2 MISSION shRNA shRNA Plasmid DNA
FCH and double SH3 domains 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014824.1-2850s1c1
Sequence:CCGGGCCCTGAATTTAGCACCAATTCTCGAGAATTGGTGCTAAATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147035    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014824.1-3054s1c1
Sequence:CCGGCGGATCTGAAATTAGCCAATACTCGAGTATTGGCTAATTTCAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014824.1-1378s1c1
Sequence:CCGGCGCTTAATGCAGATACCGAAACTCGAGTTTCGGTATCTGCATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014824.1-302s1c1
Sequence:CCGGGAATGATTACAGGAGCATGTACTCGAGTACATGCTCCTGTAATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014824.1-999s1c1
Sequence:CCGGCGACAGTTAGAATCAGAAACTCTCGAGAGTTTCTGATTCTAACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014824
VALIDATED
FCHSD2 MISSION shRNA Lentiviral Transduction Particles
FCH and double SH3 domains 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014824.1-2850s1c1
Sequence:CCGGGCCCTGAATTTAGCACCAATTCTCGAGAATTGGTGCTAAATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147035    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014824.1-3054s1c1
Sequence:CCGGCGGATCTGAAATTAGCCAATACTCGAGTATTGGCTAATTTCAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014824.1-1378s1c1
Sequence:CCGGCGCTTAATGCAGATACCGAAACTCGAGTTTCGGTATCTGCATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014824.1-302s1c1
Sequence:CCGGGAATGATTACAGGAGCATGTACTCGAGTACATGCTCCTGTAATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014824.1-999s1c1
Sequence:CCGGCGACAGTTAGAATCAGAAACTCTCGAGAGTTTCTGATTCTAACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374907
VALIDATED
FCHSD2 MISSION shRNA Bacterial Glycerol Stock
FCH and double SH3 domains 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000130412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374907.1-1310s1c1
Sequence:CCGGGCCGACAGTTAGAATCAGAAACTCGAGTTTCTGATTCTAACTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_374907.1-463s1c1
Sequence:CCGGGCCAAACATCAAGCAGAATGTCTCGAGACATTCTGCTTGATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374907.1-4331s1c1
Sequence:CCGGCCAGTCTTGTATTCTGTCTTTCTCGAGAAAGACAGAATACAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_374907.1-1474s1c1
Sequence:CCGGCGAGCAGAGCTAGAACAGAAACTCGAGTTTCTGTTCTAGCTCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374907
VALIDATED
FCHSD2 MISSION shRNA shRNA Plasmid DNA
FCH and double SH3 domains 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000130412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374907.1-1310s1c1
Sequence:CCGGGCCGACAGTTAGAATCAGAAACTCGAGTTTCTGATTCTAACTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_374907.1-463s1c1
Sequence:CCGGGCCAAACATCAAGCAGAATGTCTCGAGACATTCTGCTTGATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374907.1-4331s1c1
Sequence:CCGGCCAGTCTTGTATTCTGTCTTTCTCGAGAAAGACAGAATACAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_374907.1-1474s1c1
Sequence:CCGGCGAGCAGAGCTAGAACAGAAACTCGAGTTTCTGTTCTAGCTCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374907
VALIDATED
FCHSD2 MISSION shRNA Lentiviral Transduction Particles
FCH and double SH3 domains 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000130412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374907.1-1310s1c1
Sequence:CCGGGCCGACAGTTAGAATCAGAAACTCGAGTTTCTGATTCTAACTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_374907.1-463s1c1
Sequence:CCGGGCCAAACATCAAGCAGAATGTCTCGAGACATTCTGCTTGATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374907.1-4331s1c1
Sequence:CCGGCCAGTCTTGTATTCTGTCTTTCTCGAGAAAGACAGAATACAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_374907.1-1474s1c1
Sequence:CCGGCGAGCAGAGCTAGAACAGAAACTCGAGTTTCTGTTCTAGCTCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks