EMAIL THIS PAGE TO A FRIEND

FCN1

ficolin (collagen/fibrinogen domain containing) 1

35 Gene Product Result for
Synonyms: FCNM
UniProtKB ID: O00602, Q5VYV5, Q92596
Gene ID:
Human(2219) Summary: The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]
Rat(83517) ficolin (collagen/fibrinogen domain containing) 1
cow(497016) ficolin (collagen/fibrinogen domain containing) 1
dog(608247) ficolin (collagen/fibrinogen domain containing) 1
naked mole-rat(101724655) ficolin (collagen/fibrinogen domain containing) 1
domestic guinea pig(100724936) ficolin (collagen/fibrinogen domain containing) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002003 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002003 Rosetta Predictions human pricing
NM_031348 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038049 predicted 893
2 SASI_Hs01_00038050 predicted 916
3 SASI_Hs01_00038051 predicted 432
4 SASI_Hs01_00038054 predicted 820
5 SASI_Hs01_00038055 predicted 918
6 SASI_Hs01_00038056 predicted 944
7 SASI_Hs01_00038057 predicted 768
8 SASI_Hs01_00038052 predicted 833
9 SASI_Hs01_00038053 predicted 980
10 SASI_Hs01_00038058 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113291 predicted 665
2 SASI_Rn01_00113292 predicted 617
3 SASI_Rn01_00113293 predicted 880
4 SASI_Rn01_00113294 predicted 772
5 SASI_Rn01_00113295 predicted 655
6 SASI_Rn01_00113296 predicted 1003
7 SASI_Rn02_00264584 predicted 881
8 SASI_Rn01_00113297 predicted 495
9 SASI_Rn02_00264585 predicted 786
10 SASI_Rn01_00113298 predicted 1013
11 SASI_Rn01_00113299 predicted 923
12 SASI_Rn01_00113300 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002003
FCN1 MISSION shRNA Bacterial Glycerol Stock
ficolin (collagen/fibrinogen domain containing) 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-932s1c1
Sequence:CCGGCGCCGACTGTCATGCTTCAAACTCGAGTTTGAAGCATGACAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-135s1c1
Sequence:CCGGCTGCTAGTCTTGTTCCTGCATCTCGAGATGCAGGAACAAGACTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-294s1c1
Sequence:CCGGGTCATTGGAGAGAGAGGAGAACTCGAGTTCTCCTCTCTCTCCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-993s1c1
Sequence:CCGGGCCAATGGTATCAACTGGAGTCTCGAGACTCCAGTTGATACCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-777s1c1
Sequence:CCGGGCAGAGAAGTACAAGCTGGTACTCGAGTACCAGCTTGTACTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002003.2-818s21c1
Sequence:CCGGCAGTGCGGGTAATTCTCTAACCTCGAGGTTAGAGAATTACCCGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002003.2-851s21c1
Sequence:CCGGCAACTTCTTCTCCACCAAAGACTCGAGTCTTTGGTGGAGAAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002003
FCN1 MISSION shRNA shRNA Plasmid DNA
ficolin (collagen/fibrinogen domain containing) 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-932s1c1
Sequence:CCGGCGCCGACTGTCATGCTTCAAACTCGAGTTTGAAGCATGACAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-135s1c1
Sequence:CCGGCTGCTAGTCTTGTTCCTGCATCTCGAGATGCAGGAACAAGACTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-294s1c1
Sequence:CCGGGTCATTGGAGAGAGAGGAGAACTCGAGTTCTCCTCTCTCTCCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-993s1c1
Sequence:CCGGGCCAATGGTATCAACTGGAGTCTCGAGACTCCAGTTGATACCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-777s1c1
Sequence:CCGGGCAGAGAAGTACAAGCTGGTACTCGAGTACCAGCTTGTACTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002003.2-818s21c1
Sequence:CCGGCAGTGCGGGTAATTCTCTAACCTCGAGGTTAGAGAATTACCCGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002003.2-851s21c1
Sequence:CCGGCAACTTCTTCTCCACCAAAGACTCGAGTCTTTGGTGGAGAAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002003
FCN1 MISSION shRNA Lentiviral Transduction Particles
ficolin (collagen/fibrinogen domain containing) 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-932s1c1
Sequence:CCGGCGCCGACTGTCATGCTTCAAACTCGAGTTTGAAGCATGACAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-135s1c1
Sequence:CCGGCTGCTAGTCTTGTTCCTGCATCTCGAGATGCAGGAACAAGACTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-294s1c1
Sequence:CCGGGTCATTGGAGAGAGAGGAGAACTCGAGTTCTCCTCTCTCTCCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-993s1c1
Sequence:CCGGGCCAATGGTATCAACTGGAGTCTCGAGACTCCAGTTGATACCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002003.2-777s1c1
Sequence:CCGGGCAGAGAAGTACAAGCTGGTACTCGAGTACCAGCTTGTACTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002003.2-818s21c1
Sequence:CCGGCAGTGCGGGTAATTCTCTAACCTCGAGGTTAGAGAATTACCCGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002003.2-851s21c1
Sequence:CCGGCAACTTCTTCTCCACCAAAGACTCGAGTCTTTGGTGGAGAAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks