EMAIL THIS PAGE TO A FRIEND

FCN3

ficolin (collagen/fibrinogen domain containing) 3

46 Gene Product Result for
Synonyms: FCNH HAKA1
UniProtKB ID: O75636, Q6IBJ5, Q8WW86
Gene ID:
Human(8547) Summary: Ficolins are a group of proteins which consist of a collagen-like domain and a fibrinogen-like domain. In human serum, there are two types of ficolins, both of which have lectin activity. The protein encoded by this gene is a thermolabile beta-2-macroglycoprotein found in all human serum and is a member of the ficolin/opsonin p35 lectin family. The protein, which was initially identified based on its reactivity with sera from patients with systemic lupus erythematosus, has been shown to have a calcium-independent lectin activity. The protein can activate the complement pathway in association with MASPs and sMAP, thereby aiding in host defense through the activation of the lectin pathway. Alternative splicing occurs at this locus and two variants, each encoding a distinct isoform, have been identified. [provided by RefSeq, Jul 2008]
dog(100685339) ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen)
Horse(100070924) ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen)
cow(782648) ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen)
domestic cat(101082073) ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen)
domestic guinea pig(100736025) ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen)
naked mole-rat(101698364) ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen)
sheep(101113473) ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0565 AQUA Peptide QDGSVDFF[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003665 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067931 MISSION® esiRNA esiRNA human FCN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003665 Rosetta Predictions human pricing
NM_173452 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336046 predicted 546
2 SASI_Hs02_00336047 predicted 567
3 SASI_Hs02_00336048 predicted 549
4 SASI_Hs01_00216585 predicted 728
5 SASI_Hs02_00336049 predicted 766
6 SASI_Hs01_00216586 predicted 556
7 SASI_Hs01_00216588 predicted 704
8 SASI_Hs01_00216589 predicted 770
9 SASI_Hs01_00216590 predicted 760
10 SASI_Hs01_00216592 predicted 566
11 SASI_Hs01_00216583 predicted 514
12 SASI_Hs01_00216584 predicted 512
13 SASI_Hs01_00216587 predicted 500
14 SASI_Hs01_00216591 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368193 predicted 515
2 SASI_Hs02_00368194 predicted 539
3 SASI_Hs02_00368195 predicted 517
4 SASI_Hs01_00019674 predicted 693
5 SASI_Hs02_00368196 predicted 732
6 SASI_Hs01_00019675 predicted 524
7 SASI_Hs01_00019677 predicted 665
8 SASI_Hs01_00019678 predicted 738
9 SASI_Hs01_00019679 predicted 728
10 SASI_Hs01_00019681 predicted 538
11 SASI_Hs01_00019672 predicted 485
12 SASI_Hs01_00019673 predicted 485
13 SASI_Hs01_00019676 predicted 473
14 SASI_Hs01_00019680 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003665
FCN3 MISSION shRNA Bacterial Glycerol Stock
ficolin (collagen/fibrinogen domain containing) 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-561s1c1
Sequence:CCGGCTTTAATGGTAACCGTACTTTCTCGAGAAAGTACGGTTACCATTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-717s1c1
Sequence:CCGGCCACGATTCAAGCAACAGCAACTCGAGTTGCTGTTGCTTGAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-425s1c1
Sequence:CCGGCTGTGGATTTCTTCCGCTCTTCTCGAGAAGAGCGGAAGAAATCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-825s1c1
Sequence:CCGGCGCCCACAAATATGGCATTGACTCGAGTCAATGCCATATTTGTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-772s1c1
Sequence:CCGGGCATCCTGTTACCGATCAAATCTCGAGATTTGATCGGTAACAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003665.2-516s21c1
Sequence:CCGGGCTTACTCTCCAGGGTAACTGCTCGAGCAGTTACCCTGGAGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003665
FCN3 MISSION shRNA shRNA Plasmid DNA
ficolin (collagen/fibrinogen domain containing) 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-561s1c1
Sequence:CCGGCTTTAATGGTAACCGTACTTTCTCGAGAAAGTACGGTTACCATTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-717s1c1
Sequence:CCGGCCACGATTCAAGCAACAGCAACTCGAGTTGCTGTTGCTTGAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-425s1c1
Sequence:CCGGCTGTGGATTTCTTCCGCTCTTCTCGAGAAGAGCGGAAGAAATCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-825s1c1
Sequence:CCGGCGCCCACAAATATGGCATTGACTCGAGTCAATGCCATATTTGTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-772s1c1
Sequence:CCGGGCATCCTGTTACCGATCAAATCTCGAGATTTGATCGGTAACAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003665.2-516s21c1
Sequence:CCGGGCTTACTCTCCAGGGTAACTGCTCGAGCAGTTACCCTGGAGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003665
FCN3 MISSION shRNA Lentiviral Transduction Particles
ficolin (collagen/fibrinogen domain containing) 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-561s1c1
Sequence:CCGGCTTTAATGGTAACCGTACTTTCTCGAGAAAGTACGGTTACCATTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-717s1c1
Sequence:CCGGCCACGATTCAAGCAACAGCAACTCGAGTTGCTGTTGCTTGAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-425s1c1
Sequence:CCGGCTGTGGATTTCTTCCGCTCTTCTCGAGAAGAGCGGAAGAAATCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-825s1c1
Sequence:CCGGCGCCCACAAATATGGCATTGACTCGAGTCAATGCCATATTTGTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003665.2-772s1c1
Sequence:CCGGGCATCCTGTTACCGATCAAATCTCGAGATTTGATCGGTAACAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003665.2-516s21c1
Sequence:CCGGGCTTACTCTCCAGGGTAACTGCTCGAGCAGTTACCCTGGAGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks