EMAIL THIS PAGE TO A FRIEND

FCRL1

Fc receptor-like 1

106 Gene Product Result for
Synonyms: CD307a FCRH1 IFGP1 IRTA5
UniProtKB ID: Q96LA6, B2RE05, Q8N759, Q8NDI0, Q96PJ6
Gene ID:
Human(115350) Summary: This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein contains three extracellular C2-like immunoglobulin domains, a transmembrane domain and a cytoplasmic domain with two immunoreceptor-tyrosine activation motifs. This protein may play a role in the regulation of cancer cell growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(229499) Fc receptor-like 1
Rat(680665) Fc receptor-like 1
sheep(101109053) Fc receptor-like 1
domestic guinea pig(100729714) Fc receptor-like 1
naked mole-rat(101710016) Fc receptor-like 1
cow(517846) Fc receptor-like 1
dog(612035) Fc receptor-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1453 Human FCRL1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052938 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157701 MISSION® esiRNA esiRNA human FCRL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052938 Rosetta Predictions human pricing
XM_001058249 Rosetta Predictions rat pricing
NM_153090 Rosetta Predictions mouse pricing
NM_178165 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112664 predicted 1333
2 SASI_Hs02_00361723 predicted 1345
3 SASI_Hs01_00112665 predicted 588
4 SASI_Hs01_00112666 predicted 966
5 SASI_Hs01_00112667 predicted 450
6 SASI_Hs01_00112668 predicted 1432
7 SASI_Hs01_00112669 predicted 1406
8 SASI_Hs01_00112670 predicted 594
9 SASI_Hs01_00112672 predicted 529
10 SASI_Hs02_00361724 predicted 1320
11 SASI_Hs01_00112671 predicted 1364
12 SASI_Hs01_00112673 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289089 predicted 1025
2 SASI_Rn02_00289090 predicted 990
3 SASI_Rn02_00289091 predicted 998
4 SASI_Rn02_00289092 predicted 984
5 SASI_Rn02_00289093 predicted 987
6 SASI_Rn02_00289094 predicted 997
7 SASI_Rn02_00289095 predicted 981
8 SASI_Rn02_00289096 predicted 1000
9 SASI_Rn02_00289097 predicted 990
10 SASI_Rn02_00289098 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173633 predicted 1140
2 SASI_Mm01_00173634 predicted 612
3 SASI_Mm01_00173635 predicted 230
4 SASI_Mm01_00173636 predicted 1012
5 SASI_Mm02_00342934 predicted 1031
6 SASI_Mm01_00173637 predicted 655
7 SASI_Mm01_00173639 predicted 633
8 SASI_Mm01_00173640 predicted 1074
9 SASI_Mm01_00173641 predicted 976
10 SASI_Mm01_00173642 predicted 1019
11 SASI_Mm01_00173638 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175773 predicted 1152
2 SASI_Mm01_00175774 predicted 623
3 SASI_Mm01_00175775 predicted 245
4 SASI_Mm01_00175776 predicted 733
5 SASI_Mm01_00175777 predicted 660
6 SASI_Mm01_00175779 predicted 637
7 SASI_Mm01_00175780 predicted 1086
8 SASI_Mm01_00175781 predicted 792
9 SASI_Mm01_00175782 predicted 987
10 SASI_Mm02_00348608 predicted 1028
11 SASI_Mm01_00175778 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052938
FCRL1 MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052938.4-1860s21c1
Sequence:CCGGTTACATGGATCATCGAGTTTCCTCGAGGAAACTCGATGATCCATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052938.4-1515s21c1
Sequence:CCGGCCATTCTCCATGGCACTATTCCTCGAGGAATAGTGCCATGGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-1117s1c1
Sequence:CCGGCCAAGAGTTCACCTACCTCAACTCGAGTTGAGGTAGGTGAACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-170s1c1
Sequence:CCGGCTGACGTGTAAGATGCCCTTTCTCGAGAAAGGGCATCTTACACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-1202s1c1
Sequence:CCGGGTTTATTCACTGGCGTACTATCTCGAGATAGTACGCCAGTGAATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-295s1c1
Sequence:CCGGGAAAGAAGACACAGGGTCATACTCGAGTATGACCCTGTGTCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-558s1c1
Sequence:CCGGCAGCAGAGTATGAGATTCCTTCTCGAGAAGGAATCTCATACTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052938
FCRL1 MISSION shRNA shRNA Plasmid DNA
Fc receptor-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052938.4-1860s21c1
Sequence:CCGGTTACATGGATCATCGAGTTTCCTCGAGGAAACTCGATGATCCATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052938.4-1515s21c1
Sequence:CCGGCCATTCTCCATGGCACTATTCCTCGAGGAATAGTGCCATGGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-1117s1c1
Sequence:CCGGCCAAGAGTTCACCTACCTCAACTCGAGTTGAGGTAGGTGAACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-170s1c1
Sequence:CCGGCTGACGTGTAAGATGCCCTTTCTCGAGAAAGGGCATCTTACACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-1202s1c1
Sequence:CCGGGTTTATTCACTGGCGTACTATCTCGAGATAGTACGCCAGTGAATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-295s1c1
Sequence:CCGGGAAAGAAGACACAGGGTCATACTCGAGTATGACCCTGTGTCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-558s1c1
Sequence:CCGGCAGCAGAGTATGAGATTCCTTCTCGAGAAGGAATCTCATACTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052938
FCRL1 MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052938.4-1860s21c1
Sequence:CCGGTTACATGGATCATCGAGTTTCCTCGAGGAAACTCGATGATCCATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052938.4-1515s21c1
Sequence:CCGGCCATTCTCCATGGCACTATTCCTCGAGGAATAGTGCCATGGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-1117s1c1
Sequence:CCGGCCAAGAGTTCACCTACCTCAACTCGAGTTGAGGTAGGTGAACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-170s1c1
Sequence:CCGGCTGACGTGTAAGATGCCCTTTCTCGAGAAAGGGCATCTTACACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-1202s1c1
Sequence:CCGGGTTTATTCACTGGCGTACTATCTCGAGATAGTACGCCAGTGAATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-295s1c1
Sequence:CCGGGAAAGAAGACACAGGGTCATACTCGAGTATGACCCTGTGTCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052938.3-558s1c1
Sequence:CCGGCAGCAGAGTATGAGATTCCTTCTCGAGAAGGAATCTCATACTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153090
FCRL1 MISSION shRNA Bacterial Glycerol Stock
Fc receptor-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153090.1-1179s1c1
Sequence:CCGGCGGTTCATTAGATGAGTCCTTCTCGAGAAGGACTCATCTAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-975s1c1
Sequence:CCGGCACGGAGTAAGTGAGTCCTTTCTCGAGAAAGGACTCACTTACTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-1022s1c1
Sequence:CCGGGCCAAGGATAAACATTGCACACTCGAGTGTGCAATGTTTATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-729s1c1
Sequence:CCGGCCCATCACCATGGCCTTAATACTCGAGTATTAAGGCCATGGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-179s1c1
Sequence:CCGGCACTGGGAATATAACTTACTTCTCGAGAAGTAAGTTATATTCCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153090
FCRL1 MISSION shRNA shRNA Plasmid DNA
Fc receptor-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153090.1-1179s1c1
Sequence:CCGGCGGTTCATTAGATGAGTCCTTCTCGAGAAGGACTCATCTAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-975s1c1
Sequence:CCGGCACGGAGTAAGTGAGTCCTTTCTCGAGAAAGGACTCACTTACTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-1022s1c1
Sequence:CCGGGCCAAGGATAAACATTGCACACTCGAGTGTGCAATGTTTATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-729s1c1
Sequence:CCGGCCCATCACCATGGCCTTAATACTCGAGTATTAAGGCCATGGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-179s1c1
Sequence:CCGGCACTGGGAATATAACTTACTTCTCGAGAAGTAAGTTATATTCCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153090
FCRL1 MISSION shRNA Lentiviral Transduction Particles
Fc receptor-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153090.1-1179s1c1
Sequence:CCGGCGGTTCATTAGATGAGTCCTTCTCGAGAAGGACTCATCTAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-975s1c1
Sequence:CCGGCACGGAGTAAGTGAGTCCTTTCTCGAGAAAGGACTCACTTACTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-1022s1c1
Sequence:CCGGGCCAAGGATAAACATTGCACACTCGAGTGTGCAATGTTTATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-729s1c1
Sequence:CCGGCCCATCACCATGGCCTTAATACTCGAGTATTAAGGCCATGGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153090.1-179s1c1
Sequence:CCGGCACTGGGAATATAACTTACTTCTCGAGAAGTAAGTTATATTCCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks